Gene.AC | Gene.DE | Factor.OS | Site.AC | Factor.AC | Factor.FA | Factor.CL | Class.CL | Site.SQ G000868 | actin | yeast | R00020 | T00725 | REB1 | C0022 | tryptophan cluster | atttctCTGTCACCGgcctc G000871 | alcohol dehydrogenase 2 | yeast | R00074 | T00011 | ADR1 | C0001 | zinc finger | TCTCC G000871 | alcohol dehydrogenase 2 | yeast | R00075 | T00011 | ADR1 | C0001 | zinc finger | ---- G000871 | alcohol dehydrogenase 2 | yeast | R00076 | T00011 | ADR1 | C0001 | zinc finger | TCTCCAACTTATAAGTTGGAGA G000889 | cell division cycle gene 9 | yeast | R00206 | T00725 | REB1 | C0022 | tryptophan cluster | TTCATCATTACCCGGATGAT G000229 | matrix metalloproteinase 1 | fission yeast | R00235 | T00676 | pap1 | C0008 | basic region + leucine zipper | ATGAGTCAGA G000901 | catalase T | yeast | R00253 | T00346 | HAP1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | AGAACCTCCGTTATCTCCATTCC G000904 | mitochondrial iso-1-cytochrome C | yeast | R00257 | T00346 | HAP1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TGGCCGGGGTTTACGGACGATGA G000904 | mitochondrial iso-1-cytochrome C | yeast | R00262 | T00350 | HAP3 | C0030 | histone fold | ctcatttggcgagcGTTGGt G000904 | mitochondrial iso-1-cytochrome C | yeast | R00264 | T00350 | HAP3 | C0030 | histone fold | ctcatttggcgagcGTTGGt G000905 | iso-2-cytochrome C | yeast | R00265 | T00346 | HAP1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | GCTAATAGCGATAATAGCGAGGG G000005 | E2-early promoter | fission yeast | R00329 | T01277 | spE2F | C0023 | fork head domain | gaaaggGCGCGAAActa G000008 | early gene 4 | fission yeast | R00352 | T00050 | atf1 | C0008 | basic region + leucine zipper | TGACGTAAC G000008 | early gene 4 | fission yeast | R00362 | T00050 | atf1 | C0008 | basic region + leucine zipper | ACGTCA G000218 | ---- | yeast | R00466 | T00043 | ARG80 | C0014 | MCM1-agamous-deficiens-SRF | CAGGATGTCCATATTAGGACATC G000218 | ---- | yeast | R00466 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | CAGGATGTCCATATTAGGACATC G000486 | ---- | yeast | R00474 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | GATGTCCatATtaGGACATC G000919 | galactokinase-galactose epimerase | yeast | R00488 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGATTAGAAGCCGCCG G000919 | galactokinase-galactose epimerase | yeast | R00489 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGGTGACAGCCCTCCGA G000919 | galactokinase-galactose epimerase | yeast | R00489 | T00458 | LAC9 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGGTGACAGCCCTCCGA G000919 | galactokinase-galactose epimerase | yeast | R00489 | T00725 | REB1 | C0022 | tryptophan cluster | CGGGTGACAGCCCTCCGA G000919 | galactokinase-galactose epimerase | yeast | R00490 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | AGGAAGACTCTCCTCCG G000919 | galactokinase-galactose epimerase | yeast | R00491 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGCGCCGCACTGCTCCGAACAAT G000919 | galactokinase-galactose epimerase | yeast | R00492 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | GAgGA G000919 | galactokinase-galactose epimerase | yeast | R00494 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | GAtAA G000919 | galactokinase-galactose epimerase | yeast | R00495 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | AGCCT G000919 | galactokinase-galactose epimerase | yeast | R00496 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | GGGG G000919 | galactokinase-galactose epimerase | yeast | R00497 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | ATATAA G000920 | galactose permease | yeast | R00499 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CACCGGCGGTCTTTCGTCCGTGC G000920 | galactose permease | yeast | R00500 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TATCGGGGCGGATCACTCCGAAC G000923 | galactose transferase | yeast | R00502 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | ATACTTCGGAGCACTGTTGAGCG G000923 | galactose transferase | yeast | R00503 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | AGCGCTCGGACAACTGTTGACC G000924 | regulatory protein GAL80 | yeast | R00504 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGcgcActcTcgcCCG G000926 | imidazoleglycerol-phosphate dehydratase | yeast | R00644 | T00321 | GCN4 | C0008 | basic region + leucine zipper | TGACGA G000926 | imidazoleglycerol-phosphate dehydratase | yeast | R00645 | T00321 | GCN4 | C0008 | basic region + leucine zipper | GAGTCA G000926 | imidazoleglycerol-phosphate dehydratase | yeast | R00646 | T00321 | GCN4 | C0008 | basic region + leucine zipper | TAGTCAgggAAGTCA G000926 | imidazoleglycerol-phosphate dehydratase | yeast | R00647 | T00321 | GCN4 | C0008 | basic region + leucine zipper | TTACTC G000926 | imidazoleglycerol-phosphate dehydratase | yeast | R00648 | T00321 | GCN4 | C0008 | basic region + leucine zipper | TGACTC G000926 | imidazoleglycerol-phosphate dehydratase | yeast | R00649 | T00321 | GCN4 | C0008 | basic region + leucine zipper | ATGACTCAT G000926 | imidazoleglycerol-phosphate dehydratase | yeast | R00649 | T01306 | SKO1 | C0008 | basic region + leucine zipper | ATGACTCAT G000927 | histidine metabolism gene | yeast | R00650 | T01027 | BAS1 | C0022 | tryptophan cluster | TAATAGTGACTCCGGTAAATT G000927 | histidine metabolism gene | yeast | R00651 | T00321 | GCN4 | C0008 | basic region + leucine zipper | TGACTC G000927 | histidine metabolism gene | yeast | R00652 | T00689 | PHO2 | C0006 | homeodomain; homeobox protein | TAATAGTGACTCCGGTAAATTAGTTAATTAA G000927 | histidine metabolism gene | yeast | R00652 | T01027 | BAS1 | C0022 | tryptophan cluster | TAATAGTGACTCCGGTAAATTAGTTAATTAA G000927 | histidine metabolism gene | yeast | R00653 | T00689 | PHO2 | C0006 | homeodomain; homeobox protein | GGTAAATTAGTTAATTAATT G000927 | histidine metabolism gene | yeast | R00655 | T00321 | GCN4 | C0008 | basic region + leucine zipper | TGACTC G000927 | histidine metabolism gene | yeast | R00656 | T00321 | GCN4 | C0008 | basic region + leucine zipper | CAGTCA G000927 | histidine metabolism gene | yeast | R00657 | T00321 | GCN4 | C0008 | basic region + leucine zipper | TGACTA G000930 | endonuclease | yeast | R00718 | T00487 | MATalpha2 | C0006 | homeodomain; homeobox protein | ATGTTATTATTTACAT G000930 | endonuclease | yeast | R00718 | T00488 | MATa1 | C0006 | homeodomain; homeobox protein | ATGTTATTATTTACAT G000930 | endonuclease | yeast | R00719 | T00096 | CCBF | C0009 | leucine zipper | ---- G000930 | endonuclease | yeast | R00719 | T00775 | SWI4 | C0009 | leucine zipper | ---- G000930 | endonuclease | yeast | R00719 | T01013 | SWI6 | C0009 | leucine zipper | ---- G000930 | endonuclease | yeast | R00720 | T00096 | CCBF | C0009 | leucine zipper | GATCCACGAAAA G000930 | endonuclease | yeast | R00720 | T00775 | SWI4 | C0009 | leucine zipper | GATCCACGAAAA G000930 | endonuclease | yeast | R00720 | T01013 | SWI6 | C0009 | leucine zipper | GATCCACGAAAA G000937 | threonine deaminase | yeast | R00829 | T00321 | GCN4 | C0008 | basic region + leucine zipper | GAGTCA G000937 | threonine deaminase | yeast | R00830 | T00321 | GCN4 | C0008 | basic region + leucine zipper | TGAGTG G000937 | threonine deaminase | yeast | R00831 | T00321 | GCN4 | C0008 | basic region + leucine zipper | AAGTCA G000938 | acetolactate synthase | yeast | R00832 | T00321 | GCN4 | C0008 | basic region + leucine zipper | TGATTC G000434 | beta-galactosidase | yeast | R00962 | T00458 | LAC9 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGAAATTTGTGGTCCG G000941 | beta-isopropyl-malate dehydrogenase | yeast | R00969 | T00465 | LEU3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | AGGTGAGAGGCCGGAACCGGCTTTTCATAT G000010 | major late promoter | yeast | R00990 | T00350 | HAP3 | C0030 | histone fold | ---- G000947 | mating type protein MAT-alpha | yeast | R01019 | T00487 | MATalpha2 | C0006 | homeodomain; homeobox protein | GATGTCTGGGTTTT G000947 | mating type protein MAT-alpha | yeast | R01019 | T00488 | MATa1 | C0006 | homeodomain; homeobox protein | GATGTCTGGGTTTT G000948 | alpha-galactosidase | yeast | R01020 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TTCGGccatatgtcttCCGAA G000952 | pheromone-alpha factor | yeast | R01045 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | TTTCCGAATTAGGAAT G000952 | pheromone-alpha factor | yeast | R01046 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | TTTCCTAATTAGTCCTTCAATAGAAC G000952 | pheromone-alpha factor | yeast | R01047 | T00486 | MATalpha1 | C0006 | homeodomain; homeobox protein | cttCCTAATTAGGccaTCAACGacag G000952 | pheromone-alpha factor | yeast | R01047 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | cttCCTAATTAGGccaTCAACGacag G000953 | alpha2 factor pheromone | yeast | R01048 | T00486 | MATalpha1 | C0006 | homeodomain; homeobox protein | TTTCTTCATTGGTACATCAATGCCAG G000953 | alpha2 factor pheromone | yeast | R01048 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | TTTCTTCATTGGTACATCAATGCCAG G000957 | acid phosphatase | yeast | R01207 | T00690 | PHO4 | C0010 | basic region + helix-loop-helix motif | AATTAGCACGTTTTCGCATA G000957 | acid phosphatase | yeast | R01208 | T00689 | PHO2 | C0006 | homeodomain; homeobox protein | GAATAGGCAATCTCTAAA G000957 | acid phosphatase | yeast | R01209 | T00690 | PHO4 | C0010 | basic region + helix-loop-helix motif | GCACTCACACGTGGGA G000965 | ---- | yeast | R01304 | T00725 | REB1 | C0022 | tryptophan cluster | caatggCCGCTACCCGcctctt G000985 | pheromone alpha-factor receptor | yeast | R01361 | T00487 | MATalpha2 | C0006 | homeodomain; homeobox protein | AAGTACAT G000985 | pheromone alpha-factor receptor | yeast | R01363 | T00487 | MATalpha2 | C0006 | homeodomain; homeobox protein | ttcCTAATTGGgtaa G000985 | pheromone alpha-factor receptor | yeast | R01363 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | ttcCTAATTGGgtaa G000986 | cell type-specific sterile gene | yeast | R01364 | T00486 | MATalpha1 | C0006 | homeodomain; homeobox protein | CTGTCATTGTGACACTAATTAGGAAA G000986 | cell type-specific sterile gene | yeast | R01364 | T00487 | MATalpha2 | C0006 | homeodomain; homeobox protein | CTGTCATTGTGACACTAATTAGGAAA G000986 | cell type-specific sterile gene | yeast | R01364 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | CTGTCATTGTGACACTAATTAGGAAA G000987 | P-glycoprotein | yeast | R01365 | T00487 | MATalpha2 | C0006 | homeodomain; homeobox protein | atgtaattaCCTAATAGGGaaattt G000987 | P-glycoprotein | yeast | R01365 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | atgtaattaCCTAATAGGGaaattt G000836 | simian virus 40 | yeast | R01383 | T00321 | GCN4 | C0008 | basic region + leucine zipper | CTGACTAA G000836 | simian virus 40 | fission yeast | R01383 | T00676 | pap1 | C0008 | basic region + leucine zipper | CTGACTAA G000836 | simian virus 40 | yeast | R01384 | T00028 | YAP1 | C0008 | basic region + leucine zipper | ---- G000836 | simian virus 40 | yeast | R01385 | T00028 | YAP1 | C0008 | basic region + leucine zipper | CTGACTAA G000836 | simian virus 40 | yeast | R01394 | T00028 | YAP1 | C0008 | basic region + leucine zipper | CTGACTAA G000836 | simian virus 40 | yeast | R01394 | T00321 | GCN4 | C0008 | basic region + leucine zipper | CTGACTAA G000836 | simian virus 40 | yeast | R01412 | T00028 | YAP1 | C0008 | basic region + leucine zipper | TGTGTCA G000995 | tryptophan synthetase | yeast | R01466 | T00725 | REB1 | C0022 | tryptophan cluster | tatacctTTATTACCCGaaagg G000993 | N-(5'-phosphoribosyl)anthranilate isomerase | yeast | R01467 | T00725 | REB1 | C0022 | tryptophan cluster | acgcgcCGCTCACCCGcacgg G000997 | transposon | yeast | R01476 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | TGACTTTCCAAATTGGGTTAAAA G000997 | transposon | yeast | R01477 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | ATCTCGGTGGTATTATTCCGACAGTAAACGGAAAA G001002 | telomeric sequence X40 | yeast | R01600 | T00725 | REB1 | C0022 | tryptophan cluster | tcactgCACTTACCCTgCCATTACCCTaccatc G001003 | telomeric sequence Y30 | yeast | R01601 | T00725 | REB1 | C0022 | tryptophan cluster | tgttgtCTCTTACCCGgatgttca G000945 | maltose permease-maltase | yeast | R01632 | T00480 | MAL63 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCTTGCAACTCGCTTAAACTCTCGCTTTTAGATAATATTTCT G000945 | maltose permease-maltase | yeast | R01633 | T00480 | MAL63 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | GATTTATCCGGAAATTTTCGCGGAC G000904 | mitochondrial iso-1-cytochrome C | yeast | R01791 | T00302 | GAL4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGGTGACAGCCCTCCGaCGGGTGACAGCCCTCCGaCGGGTGACAGCCCTCCG G000218 | ---- | yeast | R01889 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | CCATATTAGG G000986 | cell type-specific sterile gene | yeast | R01891 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | ACTAATTAGG G000986 | cell type-specific sterile gene | yeast | R01900 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | ACACTAATTAGGAA G000952 | pheromone-alpha factor | yeast | R01901 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | CCTAATTAGG G000887 | cell division cycle gene 28 | yeast | R01902 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | CCTAATTAGG G000994 | anthranilate phosphoribosyl transferase | yeast | R02022 | T00321 | GCN4 | C0008 | basic region + leucine zipper | TTGACTCTCtaaaaaATGATTCAT G000994 | anthranilate phosphoribosyl transferase | yeast | R02023 | T00321 | GCN4 | C0008 | basic region + leucine zipper | ATGACTAAT G000988 | invertase (sucrose hydrolyzing enzyme) | yeast | R02024 | T00509 | MIG1 | C0001 | zinc finger | CCCCGCaTTTTT G000988 | invertase (sucrose hydrolyzing enzyme) | yeast | R02025 | T00509 | MIG1 | C0001 | zinc finger | AATTAtCCGGGGGCG G000930 | endonuclease | yeast | R02114 | T00776 | SWI5 | C0001 | zinc finger | AAAAACCAGCATGCTATAATGCT G000966 | ---- | yeast | R02406 | T00725 | REB1 | C0022 | tryptophan cluster | ---- G001001 | orotidine-5'-phosphate decarboxylase | yeast | R02407 | T00695 | PPR1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TTCGGTAATCTCCGAA G000947 | mating type protein MAT-alpha | yeast | R02482 | T00487 | MATalpha2 | C0006 | homeodomain; homeobox protein | CCCAATGTAGAAAAGTACATCATATG G000947 | mating type protein MAT-alpha | yeast | R02482 | T00488 | MATa1 | C0006 | homeodomain; homeobox protein | CCCAATGTAGAAAAGTACATCATATG G000962 | proline oxidase | yeast | R02903 | T01163 | PUT3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | ---- G000962 | proline oxidase | yeast | R02904 | T01163 | PUT3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | ---- G000963 | delta-1-pyrroline-5-carboxylate dehydrogenase | yeast | R02905 | T01163 | PUT3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | ---- G000875 | chorismate mutase | yeast | R02919 | T00321 | GCN4 | C0008 | basic region + leucine zipper | ---- G000900 | catalase A | yeast | R02962 | T00011 | ADR1 | C0001 | zinc finger | TCCCCACAGTGACAGAATTGGAGAAA G000958 | repressible alkaline phosphatase | yeast | R02975 | T00690 | PHO4 | C0010 | basic region + helix-loop-helix motif | CCACGTGCAGCG G000874 | acetylglutamate kinase and acetylglutamyl-phosphate reductase | yeast | R03057 | T00043 | ARG80 | C0014 | MCM1-agamous-deficiens-SRF | ---- G000874 | acetylglutamate kinase and acetylglutamyl-phosphate reductase | yeast | R03057 | T00044 | ARG81 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | ---- G000874 | acetylglutamate kinase and acetylglutamyl-phosphate reductase | yeast | R03057 | T00500 | MCM1 | C0014 | MCM1-agamous-deficiens-SRF | ---- G000903 | cytochrome b2 | yeast | R03326 | T00346 | HAP1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CCTGCCGATATCTCCTTGCCCC G000940 | inositol-1-phosphate synthase | yeast | R03358 | T01241 | INO2 | C0010 | basic region + helix-loop-helix motif | ATGTGAAAA AATTCACAT G000906 | cytochrome c1 | yeast | R03498 | T00346 | HAP1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | GCGGCCGGTATTTCCGGCGGC G000225 | ---- | fission yeast | R03576 | T01275 | mat1-Mc | C0015 | high-mobility group protein-like factors | actgagAACAAAGcgctctcacac G000899 | cyclin 2 | yeast | R03735 | T00096 | CCBF | C0009 | leucine zipper | CGCGAAA CACGAAA CACGAAA G000899 | cyclin 2 | yeast | R03735 | T00775 | SWI4 | C0009 | leucine zipper | CGCGAAA CACGAAA CACGAAA G000899 | cyclin 2 | yeast | R03735 | T01013 | SWI6 | C0009 | leucine zipper | CGCGAAA CACGAAA CACGAAA G000893 | centromeric region of chromosome XII | yeast | R03743 | T00080 | CBF1 | C0010 | basic region + helix-loop-helix motif | ATCACGTG G000891 | centromeric region of chromosome IX | yeast | R03744 | T00080 | CBF1 | C0010 | basic region + helix-loop-helix motif | TTCACGTG G000892 | centromeric region of chromosome VI | yeast | R03745 | T00080 | CBF1 | C0010 | basic region + helix-loop-helix motif | ATCACGTG G000930 | endonuclease | yeast | R03752 | T00096 | CCBF | C0009 | leucine zipper | CACGAAAA G000930 | endonuclease | yeast | R03752 | T00775 | SWI4 | C0009 | leucine zipper | CACGAAAA G000930 | endonuclease | yeast | R03752 | T01013 | SWI6 | C0009 | leucine zipper | CACGAAAA G000867 | 35S ribosomal RNA | yeast | R03753 | T00725 | REB1 | C0022 | tryptophan cluster | actGGGTTACCCGGggcacctg G000867 | 35S ribosomal RNA | yeast | R03753 | T01245 | Reb1p | C0022 | tryptophan cluster | actGGGTTACCCGGggcacctg G000436 | ---- | yeast | R03754 | T00725 | REB1 | C0022 | tryptophan cluster | ---- G000436 | ---- | yeast | R03754 | T01245 | Reb1p | C0022 | tryptophan cluster | ---- G000982 | ---- | yeast | R03780 | T01247 | UME6 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | gaaaTAGCCGCCGAcaaaaaggaa G000915 | fructose-1,6-bisphosphatase | yeast | R03791 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CCATCCGTCCGGA G000996 | thioredoxin 2 | yeast | R03792 | T00028 | YAP1 | C0008 | basic region + leucine zipper | actcTTAGTAAagga G000996 | thioredoxin 2 | yeast | R03793 | T00028 | YAP1 | C0008 | basic region + leucine zipper | tcttttcTTACTAAgcgc G000988 | invertase (sucrose hydrolyzing enzyme) | yeast | R03800 | T01257 | MSN2 | C0001 | zinc finger | ---- G000988 | invertase (sucrose hydrolyzing enzyme) | yeast | R03800 | T01258 | MSN4 | C0001 | zinc finger | ---- G000998 | transposon | yeast | R03801 | T01258 | MSN4 | C0001 | zinc finger | GATGACGTGT G000998 | transposon | yeast | R03803 | T01258 | MSN4 | C0001 | zinc finger | AAACGTCACC G000894 | catabolic L-serine (L-threonine) dehydratase | yeast | R03817 | T02848 | CHA4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | GCGGAgacatggatTCCGC G000894 | catabolic L-serine (L-threonine) dehydratase | yeast | R03818 | T02848 | CHA4 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CcCAGcGGAAaTgtAaTTCC G000878 | autonomous replication sequence 1 | yeast | R03825 | T01274 | ABF2 | C0015 | high-mobility group protein-like factors | GTACAATCAATCAAAAAGC G000878 | autonomous replication sequence 1 | yeast | R03826 | T01274 | ABF2 | C0015 | high-mobility group protein-like factors | TTATC G000878 | autonomous replication sequence 1 | yeast | R03827 | T01274 | ABF2 | C0015 | high-mobility group protein-like factors | ATGCTTGCTTTTCAAAAGGCCTGCAGGCA G000877 | autonomous replication sequence H4 | yeast | R03828 | T01274 | ABF2 | C0015 | high-mobility group protein-like factors | ---- G000929 | ---- | yeast | R03829 | T01274 | ABF2 | C0015 | high-mobility group protein-like factors | ---- G000929 | ---- | yeast | R03830 | T01274 | ABF2 | C0015 | high-mobility group protein-like factors | ---- G000958 | repressible alkaline phosphatase | yeast | R03837 | T00690 | PHO4 | C0010 | basic region + helix-loop-helix motif | ATATTAAGCGTGCGGGTAA G000930 | endonuclease | yeast | R03860 | T00689 | PHO2 | C0006 | homeodomain; homeobox protein | CAATTTAAA G000930 | endonuclease | yeast | R03861 | T00689 | PHO2 | C0006 | homeodomain; homeobox protein | TTTAAAAAAAAAACCAGC G000930 | endonuclease | yeast | R03861 | T00776 | SWI5 | C0001 | zinc finger | TTTAAAAAAAAAACCAGC G000939 | initiation of meiosis | yeast | R03863 | T00731 | RME1 | C0001 | zinc finger | AAAAGAACCTCAAAAAGTCCA G000988 | invertase (sucrose hydrolyzing enzyme) | yeast | R03907 | T01306 | SKO1 | C0008 | basic region + leucine zipper | AGTACGTCAT G000959 | photolyase apoenzyme | yeast | R03998 | T03423 | RPH1 | C0001 | zinc finger | GTgAAAGTAtGctTACTTTgAC G000869 | amidophosphoribosyl transferase | yeast | R04022 | T00321 | GCN4 | C0008 | basic region + leucine zipper | TTGACTCTT G000869 | amidophosphoribosyl transferase | yeast | R04023 | T00321 | GCN4 | C0008 | basic region + leucine zipper | ATGAATAAT G000869 | amidophosphoribosyl transferase | yeast | R04024 | T00321 | GCN4 | C0008 | basic region + leucine zipper | ATGACTGCT G000867 | 35S ribosomal RNA | yeast | R04027 | T00725 | REB1 | C0022 | tryptophan cluster | atgatcCGGGTAAAAAcatgta G000151 | ---- | fission yeast | R04087 | T01422 | ste11 | C0015 | high-mobility group protein-like factors | taacTTCTTTGTTCTctaattactgtatctc G000150 | ---- | fission yeast | R04088 | T01422 | ste11 | C0015 | high-mobility group protein-like factors | atcactaaTGCTTTGTTCCctctTTCTTTGTTCCttatgcg G000434 | beta-galactosidase | yeast | R04129 | T00458 | LAC9 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGAATTCTGTTCACCG G000433 | lactose permease | yeast | R04130 | T00458 | LAC9 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGCCCACTGACTCCCG G000433 | lactose permease | yeast | R04131 | T00458 | LAC9 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGGATTCTTCCCTCCG G000919 | galactokinase-galactose epimerase | yeast | R04145 | T00509 | MIG1 | C0001 | zinc finger | TTATTTCtGGGGTA G000921 | galactokinase | yeast | R04146 | T00509 | MIG1 | C0001 | zinc finger | CCCCAGcTATTC G000922 | positive regulator of GAL genes | yeast | R04147 | T00509 | MIG1 | C0001 | zinc finger | CCCCAGaTTTTC G000948 | alpha-galactosidase | yeast | R04148 | T00509 | MIG1 | C0001 | zinc finger | ATTAAtGTGGGG G000944 | Mal2-8cp | yeast | R04149 | T00509 | MIG1 | C0001 | zinc finger | CCCCGGcTTTTA G000945 | maltose permease-maltase | yeast | R04150 | T00509 | MIG1 | C0001 | zinc finger | ATTTTtGTGGGG G000945 | maltose permease-maltase | yeast | R04151 | T00509 | MIG1 | C0001 | zinc finger | AATTGtGTGGGG G000946 | ---- | yeast | R04152 | T00509 | MIG1 | C0001 | zinc finger | CCCCGGgTTTAA G000915 | fructose-1,6-bisphosphatase | yeast | R04153 | T00509 | MIG1 | C0001 | zinc finger | TCCCCACACTAT G000955 | pyruvate decarboxylase | yeast | R04154 | T00509 | MIG1 | C0001 | zinc finger | CCCCGCgTTTAT G000925 | transcriptional activator protein of CYC1 (component of HAP2/HAP3 heteromer) | yeast | R04155 | T00509 | MIG1 | C0001 | zinc finger | CCCCAGtTTTAT G000917 | glycerol channel protein | yeast | R04156 | T00509 | MIG1 | C0001 | zinc finger | TTAAAAGCGGGG G001040 | 3'-phosphoadenylylsulfate reductase | yeast | R04629 | T00080 | CBF1 | C0010 | basic region + helix-loop-helix motif | ---- G001040 | 3'-phosphoadenylylsulfate reductase | yeast | R04629 | T02309 | MET28 | C0008 | basic region + leucine zipper | ---- G001040 | 3'-phosphoadenylylsulfate reductase | yeast | R04629 | T02310 | MET4 | C0008 | basic region + leucine zipper | ---- G001110 | M-factor pheromone 1 | fission yeast | R04762 | T01275 | mat1-Mc | C0015 | high-mobility group protein-like factors | ACAATTgactagACAATG G001110 | M-factor pheromone 1 | fission yeast | R04763 | T01275 | mat1-Mc | C0015 | high-mobility group protein-like factors | AACAAAGAA G001110 | M-factor pheromone 1 | fission yeast | R04763 | T01422 | ste11 | C0015 | high-mobility group protein-like factors | AACAAAGAA G001143 | ureidoglycolate hydrolase | yeast | R04989 | T02411 | DAL80 | C0003 | zinc finger | gaGATAAgactGATAAgaagcatatgcggtctattcatg G001144 | amino acid permease | yeast | R04991 | T02411 | DAL80 | C0003 | zinc finger | G001542 | ---- | yeast | R08468 | T02411 | DAL80 | C0003 | zinc finger | G001542 | ---- | yeast | R08468 | T02818 | GLN3 | C0003 | zinc finger | G002149 | zinc-regulated transporter | yeast | R09723 | T03717 | ZAP1 | C0001 | zinc finger | aagatACCCTCAAGGTtctca G002149 | zinc-regulated transporter | yeast | R09724 | T03717 | ZAP1 | C0001 | zinc finger | atttgACCTTGAAGGTcatgg G002149 | zinc-regulated transporter | yeast | R09725 | T03717 | ZAP1 | C0001 | zinc finger | tgcgtACCCCAAAGGTcacaa G002200 | zinc-regulated transporter | yeast | R09726 | T03717 | ZAP1 | C0001 | zinc finger | acataACCCTAAAGGTtatat G002200 | zinc-regulated transporter | yeast | R09727 | T03717 | ZAP1 | C0001 | zinc finger | aatgtACCCTAAAGGTtgtga G002201 | zinc-responsive activator protein | yeast | R09728 | T03717 | ZAP1 | C0001 | zinc finger | catctACCCTAAAGGTcatga G002205 | zinc-regulated transporter | yeast | R09740 | T03717 | ZAP1 | C0001 | zinc finger | ACCCTTAAGGT G002206 | substrate and inhibitor of Cdc28 | yeast | R09743 | T00776 | SWI5 | C0001 | zinc finger | AGCACACTGAAATTTCAATGGCTGGCTTGT G002206 | substrate and inhibitor of Cdc28 | yeast | R09744 | T00002 | ACE2 | C0001 | zinc finger | TTATAGCCAGCACACTGAAATTTCAATGGCTGGCTTGT G002207 | endochitinase | yeast | R09745 | T00002 | ACE2 | C0001 | zinc finger | GGAAATGCTGGTCCCTTGAAAAAATAACCAGCCTCGCC G002207 | endochitinase | yeast | R09745 | T00776 | SWI5 | C0001 | zinc finger | GGAAATGCTGGTCCCTTGAAAAAATAACCAGCCTCGCC G002218 | GABA-specific transport protein | yeast | R09804 | T02827 | GZF3 | C0003 | zinc finger | TAAGGTACTCTTATCGCTAATCGCTTATCGCTTATCGTGCGCCAAA G000939 | initiation of meiosis | yeast | R09883 | T04357 | YHP1 | C0006 | homeodomain; homeobox protein | CACGTAACACAGCCAATTAGTTTTCTAT G002585 | aromatic aminotransferase II | yeast | R10102 | T04566 | ARO80 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TTGCCGATGCTTACCGAGATTTGCCGCGGATAACCG G002586 | homolog of bacterial indolpyruvate decarboxylase | yeast | R10103 | T04566 | ARO80 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TAACCGCGGGATAGCCGTCATTTACCGAAAATTGCCG G002891 | ---- | yeast | R11636 | T04582 | SUT1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | AACGCGCAGG G002891 | ---- | yeast | R11647 | T04582 | SUT1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | AACGCGTGCC G002896 | ---- | yeast | R11648 | T04582 | SUT1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | ATCGCGCAATT G002911 | C-8 sterol isomerase | yeast | R11697 | T03300 | ECM22 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | cTCGTATAagc G002911 | C-8 sterol isomerase | yeast | R11697 | T04612 | UPC2 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | cTCGTATAagc G002921 | cytochrome-c oxidase chain Vb | yeast | R11728 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | TGTATTGTTCGA G002921 | cytochrome-c oxidase chain Vb | yeast | R11729 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | TCTATTGTTTAA G000905 | iso-2-cytochrome C | yeast | R11731 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | TCAATTGTTTAG G002947 | coproporphyrinogen III oxidase | yeast | R11732 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | TCAATTGTTTAG G002947 | coproporphyrinogen III oxidase | yeast | R11733 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | TGCTTTGTTCAA G002947 | coproporphyrinogen III oxidase | yeast | R11734 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | CCCATTGTTCTC G002948 | 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase isozyme | yeast | R11735 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | CCGATTGTTCGT G002959 | 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase isozyme | yeast | R11736 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | CGCATTGTTTTG G000914 | lanosterol 14alpha-demethylase | yeast | R11737 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | CCTATTGTGCAT G002949 | NADP-cytochrome P450 reductase | yeast | R11738 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | GCTATTGTTCTC G002950 | delta-9-fatty acid desaturase | yeast | R11739 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | TTTATTGTTCTA G002950 | delta-9-fatty acid desaturase | yeast | R11740 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | GGCATTGTTATC G002950 | delta-9-fatty acid desaturase | yeast | R11741 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | CCTATTGTTACG G002951 | translation initiation factor eIF-5A, anaerobically expressed form | yeast | R11742 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | TCCATTGTTCGT G002951 | translation initiation factor eIF-5A, anaerobically expressed form | yeast | R11743 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | CCTATTGTTCTC G002951 | translation initiation factor eIF-5A, anaerobically expressed form | yeast | R11744 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | TCCATTGTTCTC G002951 | translation initiation factor eIF-5A, anaerobically expressed form | yeast | R11745 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | CTCATTGTTGCT G002952 | ADP/ATP translocator | yeast | R11746 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | TTCATTGTTTGG G002953 | acetyl CoA synthetase | yeast | R11747 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CCGTTCGTCCG G000915 | fructose-1,6-bisphosphatase | yeast | R11748 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CcaTCcgTCCG G000936 | isocitrate lyase | yeast | R11749 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CCATTCATCCG G000954 | malate synthase 1 | yeast | R11750 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CCATTGGGCCG G000954 | malate synthase 1 | yeast | R11751 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGCTCAATGG G002955 | succinate-fumarate transport protein | yeast | R11753 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGTTGAATGGA G002956 | Possibly involved in Snf1p regulated transcriptional activation | yeast | R11754 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CCGTTCGACCG G002957 | NADP-dependent isocitrate dehydrogenase | yeast | R11755 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGACCACCGGC G002954 | phosphoenolpyruvate carboxylkinase | yeast | R11757 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CCTTTCATCCG G002958 | carboxylic acid transporter protein homolog | yeast | R11758 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CCACTAGACCG G002955 | succinate-fumarate transport protein | yeast | R11766 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGAGAAATGGA G002955 | succinate-fumarate transport protein | yeast | R11767 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGTTTAATGGA G002974 | HMG-domain site-specific DNA binding protein | yeast | R12071 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | CCTATTGTTGCT G002974 | HMG-domain site-specific DNA binding protein | yeast | R12072 | T01286 | ROX1 | C0015 | high-mobility group protein-like factors | CGTATTGTCTTG G002953 | acetyl CoA synthetase | yeast | R12075 | T00011 | ADR1 | C0001 | zinc finger | CTCCGAtgccattattcaatgggtattgcagTTGGGG G002953 | acetyl CoA synthetase | yeast | R12080 | T01247 | UME6 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TGCCGCCGA G002953 | acetyl CoA synthetase | yeast | R12081 | T00725 | REB1 | C0022 | tryptophan cluster | TTACCCG G002958 | carboxylic acid transporter protein homolog | yeast | R12094 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGGGGAATGGA G002982 | cytosolic malate dehydrogenase | yeast | R12095 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CCATTTGGCCG G002982 | cytosolic malate dehydrogenase | yeast | R12096 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CCTTTAATCCG G002982 | cytosolic malate dehydrogenase | yeast | R12097 | T03227 | CAT8 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CCATTCGGCCG G000959 | photolyase apoenzyme | yeast | R12098 | T01247 | UME6 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TTTTCTTCCTCGTTTTTCGAGGAAGCAGT G001907 | G1/S-specific cyclin | yeast | R12101 | T03202 | AZF1 | C0001 | zinc finger | TTTCAAGAAAAAAAAAAAGAAAAAGTGAAAAATTATCAGGCAAGAAAAAGAAATTAC G003028 | HSP70 family mammalian BiP (GPR78) homolog mammalian BiP (GPR78) homolog | yeast | R12161 | T02039 | HAC1 | C0008 | basic region + leucine zipper | GGAACTGGACAGCGTGTCGAAA G003031 | FKBP13 (FK506 binding protein) peptidyl-prolyl cis-trans isomerase (PPIase) | yeast | R12162 | T02039 | HAC1 | C0008 | basic region + leucine zipper | CATTACTGCCAGCGCATCTTCA G003032 | protein disulfide isomerase | yeast | R12163 | T02039 | HAC1 | C0008 | basic region + leucine zipper | CCAATTTGCCACCGTGTAGCAT G003032 | protein disulfide isomerase | yeast | R12164 | T02039 | HAC1 | C0008 | basic region + leucine zipper | CCTGTCGGGCGGCGCCTCTTTT G003034 | Hsp70 family | yeast | R12167 | T02039 | HAC1 | C0008 | basic region + leucine zipper | CTTTTATAACAGCGTGTTCGAT G003035 | protein disulfide isomerase homolog | yeast | R12168 | T02039 | HAC1 | C0008 | basic region + leucine zipper | TTCAAAGGCACGCGTGTCCTTT G001340 | open reading frame | yeast | R12219 | T00028 | YAP1 | C0008 | basic region + leucine zipper | TTACTAA G001340 | open reading frame | yeast | R12219 | T01239 | CAD1 | C0008 | basic region + leucine zipper | TTACTAA G001340 | open reading frame | yeast | R12219 | T03232 | CIN5 | C0008 | basic region + leucine zipper | TTACTAA G001340 | open reading frame | yeast | R12219 | T03712 | YAP3 | C0008 | basic region + leucine zipper | TTACTAA G003044 | glucokinase | yeast | R12277 | T01257 | MSN2 | C0001 | zinc finger | AGGGG G003044 | glucokinase | yeast | R12277 | T01258 | MSN4 | C0001 | zinc finger | AGGGG G003045 | gamma-aminobutyrate (GABA) transaminase (4-aminobutyrate aminotransferase) | yeast | R12280 | T03293 | DAL81 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | AAAAGCCGCGGGCGGGATT G003045 | gamma-aminobutyrate (GABA) transaminase (4-aminobutyrate aminotransferase) | yeast | R12280 | T03322 | UGA3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | AAAAGCCGCGGGCGGGATT G002218 | GABA-specific transport protein | yeast | R12281 | T03293 | DAL81 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | AAAAACCGCCGGCGGCAAT G002218 | GABA-specific transport protein | yeast | R12281 | T03322 | UGA3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | AAAAACCGCCGGCGGCAAT G002218 | GABA-specific transport protein | yeast | R12307 | T02411 | DAL80 | C0003 | zinc finger | CTTATCGCTAATCGCTTATCGCTTATCG G003824 | transcriptional activator | yeast | R12316 | T03303 | FKH1 | C0023 | fork head domain | GGTAAACAA G003824 | transcriptional activator | yeast | R12316 | T03304 | FKH2 | C0023 | fork head domain | GGTAAACAA G003825 | sensitive to sulfite | yeast | R12318 | T03312 | FZF1 | C0001 | zinc finger | CGTATCGTATAAGGCAACAATAG G000997 | transposon | yeast | R12321 | T00321 | GCN4 | C0008 | basic region + leucine zipper | ACATTCA G000983 | ---- | yeast | R12325 | T03402 | GIS1 | C0001 | zinc finger | CCTATGGAGGTTATGGGTGCCCTTAATTAGGGATC G004040 | plasma membrane Na+ pump; P-type ATPase | yeast | R12326 | T00509 | MIG1 | C0001 | zinc finger | ATTTTGCGGGGC G004040 | plasma membrane Na+ pump; P-type ATPase | yeast | R12327 | T01306 | SKO1 | C0008 | basic region + leucine zipper | TTATTTCCTACTTCTATGACGTTT G004046 | acetate-CoA ligase | yeast | R12337 | T01241 | INO2 | C0010 | basic region + helix-loop-helix motif | TATTCATATGC G004046 | acetate-CoA ligase | yeast | R12337 | T01639 | INO4 | C0010 | basic region + helix-loop-helix motif | TATTCATATGC G004042 | pentafunctional enzyme (fatty-acid synthase complex) | yeast | R12340 | T00725 | REB1 | C0022 | tryptophan cluster | TAACCCG G004043 | fatty acid synthase alpha subunit | yeast | R12342 | T00725 | REB1 | C0022 | tryptophan cluster | TTACCCG G004050 | amino acid permease for leucine, valine, and isoleucine (putative) | yeast | R12349 | T00465 | LEU3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGGAACCGG G004054 | saccharopine dehydrogenase (NAD+, L-lysine forming) | yeast | R12360 | T03472 | LYS14 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCCAGCGGA G004055 | saccharopine dehydrogenase (NADP+, L-glutamate forming) | yeast | R12361 | T03472 | LYS14 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCCGTTGGA G004055 | saccharopine dehydrogenase (NADP+, L-glutamate forming) | yeast | R12362 | T03472 | LYS14 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCCAATGGA G004069 | transcriptional activator of sulfur amino acid metabolism | yeast | R12378 | T03494 | MET31 | C0001 | zinc finger | CACGTGA G004069 | transcriptional activator of sulfur amino acid metabolism | yeast | R12378 | T03495 | MET32 | C0001 | zinc finger | CACGTGA G002951 | translation initiation factor eIF-5A, anaerobically expressed form | yeast | R12379 | T03500 | MOT3 | C0001 | zinc finger | TTGCCT G000904 | mitochondrial iso-1-cytochrome C | yeast | R12382 | T03500 | MOT3 | C0001 | zinc finger | CAGGCA G004072 | glucan 1, 4 alpha glucosidase; glucoamylase | yeast | R12384 | T03516 | NRG1 | C0001 | zinc finger | TGTCCCCTAATG G004072 | glucan 1, 4 alpha glucosidase; glucoamylase | yeast | R12385 | T03516 | NRG1 | C0001 | zinc finger | TCCCTCATTTC G004073 | necessary for synthesis of mannose-(inositol-P)2-ceramide (M(IP)2C) | yeast | R12386 | T03524 | PDR1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TTCCGCGGAA G004073 | necessary for synthesis of mannose-(inositol-P)2-ceramide (M(IP)2C) | yeast | R12386 | T03525 | PDR3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TTCCGCGGAA G004074 | multispecific organic anion transporter important for tolerance against toxic environmental organic anions | yeast | R12387 | T03524 | PDR1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | ATTTCCACGGAACCACGCG G004075 | putative ABC transporter highly similar to Pdr5p | yeast | R12388 | T03524 | PDR1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCCGTGGA G004075 | putative ABC transporter highly similar to Pdr5p | yeast | R12389 | T03524 | PDR1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCCACGGA G004076 | multidrug resistance transporter (putative) | yeast | R12390 | T03524 | PDR1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCCGCGGGA G004076 | multidrug resistance transporter (putative) | yeast | R12391 | T03524 | PDR1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCCGCGGA G004077 | high-affinity hexose transporter | yeast | R12392 | T03525 | PDR3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | ATTCCGCGGAGAAATGGT G004078 | multidrug resistance transporter | yeast | R12393 | T03524 | PDR1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | GTCTCCGCGGAACTCTTCT G004078 | multidrug resistance transporter | yeast | R12393 | T03525 | PDR3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | GTCTCCGCGGAACTCTTCT G004079 | zinc-finger transcription factor related to Pdr1p | yeast | R12394 | T03525 | PDR3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCCGCGGA G004079 | zinc-finger transcription factor related to Pdr1p | yeast | R12395 | T03525 | PDR3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCCGCGGA G004078 | multidrug resistance transporter | yeast | R12396 | T03524 | PDR1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCTCTTTCCGCGGAATCGCT G004078 | multidrug resistance transporter | yeast | R12396 | T03525 | PDR3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCTCTTTCCGCGGAATCGCT G004078 | multidrug resistance transporter | yeast | R12397 | T03524 | PDR1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TGATTCCGTGGAAAGGTC G004078 | multidrug resistance transporter | yeast | R12397 | T03525 | PDR3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TGATTCCGTGGAAAGGTC G004082 | ABC transporter | yeast | R12400 | T03525 | PDR3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCCGCGGA G004082 | ABC transporter | yeast | R12401 | T03525 | PDR3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCCGCGGA G004082 | ABC transporter | yeast | R12402 | T03525 | PDR3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCCGCGCA G004097 | 1,3-beta-glucan synthase | yeast | R12412 | T03231 | CRZ1 | C0001 | zinc finger | CACCAGTCGGTGGCTGTGCGCTTG G004050 | amino acid permease for leucine, valine, and isoleucine (putative) | yeast | R12431 | T02402 | STP1 | C0001 | zinc finger | ---- G004050 | amino acid permease for leucine, valine, and isoleucine (putative) | yeast | R12431 | T04606 | STP2 | C0001 | zinc finger | ---- G004103 | transposon | yeast | R12439 | T01684 | TEA1 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | TCGGTGGTATTATTCCGA G004124 | NADP-specific glutamate dehydrogenase | yeast | R12446 | T00465 | LEU3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | ATGCGCCGGAACCGGCCCA G000938 | acetolactate synthase | yeast | R12449 | T00465 | LEU3 | C0005 | zinc cluster; zinc-cysteine cluster; C6 zinc finger | CGCCTAGCCGCCGGAGCCTGCCGGTACCGGCTTGGC G001143 | ureidoglycolate hydrolase | yeast | R12455 | T02818 | GLN3 | C0003 | zinc finger | ---- G004148 | glutamine synthetase | yeast | R12456 | T02818 | GLN3 | C0003 | zinc finger | ---- G000962 | proline oxidase | yeast | R12457 | T02818 | GLN3 | C0003 | zinc finger | ---- G002218 | GABA-specific transport protein | yeast | R12458 | T02818 | GLN3 | C0003 | zinc finger | ---- G004147 | NAD-dependent glutamate dehydrogenase | yeast | R12459 | T02818 | GLN3 | C0003 | zinc finger | ---- G000883 | arginase | yeast | R12460 | T02818 | GLN3 | C0003 | zinc finger | ---- G004150 | non-mitochondrial citrate synthase | yeast | R12537 | T03577 | RTG1 | C0012 | basic region + helix-loop-helix motif + leucine zipper | GTGACCTTTTCCGTAG G004150 | non-mitochondrial citrate synthase | yeast | R12537 | T03579 | RTG3 | C0012 | basic region + helix-loop-helix motif + leucine zipper | GTGACCTTTTCCGTAG