VV TRANSFAC SITE TABLE, Release 6.2 - licensed - 2002-07-01, (C) Biobase GmbH XX // AC R00001 XX ID HS$IFI616_01 XX DT 20.06.1990 (created); ewi. DT 12.11.2001 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE IFI-6-16 (interferon-induced gene 6-16); Gene: G000176. XX SQ gGGAAAaTGAAACT. XX EL ISRE XX SF -127 ST -89 XX BF T00428; ISGF-3; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0038; Bristol 8B+ SO 0061; Daudi SO 0101; HeLa+ SO 0108; HFF SO 0380; Daudi + CML XX MM copper/phenanthroline footprinting MM gel retardation MM methylation protection MM methylation interference MM ethylation interference XX CC human foreskin fibroblasts (HFF) after induction with IFN-alpha XX DR EMBL: Y00828; HSIFNIN6 (492:505). DR EPD: EP27009; HS_INI2. XX RN [1] RX MEDLINE; 91187669. RA Roy Ch., Lebleu B. RT DNA protein interactions at the interferon-responsive promoter elements: RT potential for a H-DNA conformation RL Nucleic Acids Res. 19:517 (1991). RN [2] RX MEDLINE; 91056171. RA Seong D. C., Sims S., Johnson E., Howard O. M. Z., Reiter B., Hester J., RA Talpaz M., Kantarjian H., Deisseroth A. RT A phosphatase activity present in peripheral blood myeloid cells of chromic RT myelogenous leukemia patients but not normal individuals alters nuclear RT protein binding to transcriptional enhancers of interferon-inducible genes RL J. Clin. Invest. 86:1664-1670 (1990). RN [3] RX MEDLINE; 91067441. RA Imam A. M. A., Ackrill A. M., Dale T. C., Kerr I. M., Stark G. R. RT Transcription factors induced by interferons alpha and gamma RL Nucleic Acids Res. 18:6573-6580 (1990). RN [4] RX MEDLINE; 89251615. RA Dale T. C., Rosen J. M., Guille M. J., Lewin A. R., Porter A. G. C., Kerr RA I. M., Stark G. R. RT Overlapping sites for constitutive and induced DNA binding factors involved RT in interferon-stimulated transcription RL EMBO J. 8:831-839 (1989). RN [5] RX MEDLINE; 89145211. RA Dale T. C., Ali Imam A. M., Kerr I. M., Stark G. R. RT Rapid activation by interferon alpha of a latent DNA-binding protein RT present in the cytoplasm of untreated cells RL Proc. Natl. Acad. Sci. USA 86:1203-1207 (1989). RN [6] RX MEDLINE; 88196095. RA Porter A. C. G., Chernajowski Y., Dale T. C., Gilbert C. S., Stark G. R., RA Kerr I. M. RT Interferon response element of the human gene 6-16 RL EMBO J. 7:85-92 (1988). XX // AC R00002 XX ID HS$IFI616_02 XX DT 20.06.1990 (created); ewi. DT 12.11.2001 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE IFI-6-16 (interferon-induced gene 6-16); Gene: G000176. XX SQ GGGGAAAATGAAACTGCA. XX EL ISRE XX SF -113 ST -96 XX BF T00402; ICSBP; Quality: 6; Species: mouse, Mus musculus. XX MX M00699; V$ICSBP_Q6 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 1228; rec(human-mouse) XX MM Southwestern blotting / filter binding XX DR EMBL: Y00828; HSIFNIN6 (491:508). DR EPD: EP27009; HS_INI2. XX RN [1] RX MEDLINE; 90251633. RA Driggers P. H., Ennist D. L., Gleason S. L., Mak W.-H., Marks M. S., Levi RA B.-Z., Flanagan J. R., Appella E., Ozato K. RT An interferon gamma-regulated protein that binds the interferon-inducible RT enhancer element of major histocompatibility complex class I genes RL Proc. Natl. Acad. Sci. USA 87:3743-3747 (1990). XX // AC R00003 XX ID HS$927_01 XX DT 20.06.1990 (created); ewi. DT 28.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE 9-27 (interferon-induced RNA binding protein 9-27); Gene: G000179. XX SQ AGGAAATAGAAACT. XX EL ISRE XX SF -185 ST -147 XX BF T00965; G factor; Quality: 6; Species: human, Homo sapiens. BF T00428; ISGF-3; Quality: 6; Species: human, Homo sapiens. BF T00966; M factor; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0038; Bristol 8B+ SO 0061; Daudi SO 0101; HeLa+ SO 0108; HFF SO 0114; HT-1080 SO 0380; Daudi + CML SO 0417; HT1080+IFN-gamma + HT12S+IFN-alpha XX MM copper/phenanthroline footprinting MM direct gel shift XX CC human foreskin fibroblasts (HFF) after induction with IFN-alpha; G factor CC induced in HT1080 cells by IFN-gamma, E and M factor by IFN-alpha XX DR EMBL: J04164; HS927A (144:157). XX RN [1] RX MEDLINE; 91360336. RA Ackrill A. M., Foster G. R., Laxton C. D., Flavell D. M., Stark G. R., Kerr RA I. M. RT Inhibition of the cellular response to interferons by products of the RT adenovirus type 5 E1A oncogene RL Nucleic Acids Res. 19:4387-4393 (1991). RN [2] RX MEDLINE; 91187896. RA Foster G. R., Ackrill A. M., Goldin R. D., Kerr I. M., Thomas H. C., Stark RA G. R. RT Expression of the terminal protein region of hepatitis B virus inhibits RT cellular responses to interferons alpha and gamma and double-stranded RNA RL Proc. Natl. Acad. Sci. USA 88:2888-2892 (1991). RN [3] RX MEDLINE; 91056171. RA Seong D. C., Sims S., Johnson E., Howard O. M. Z., Reiter B., Hester J., RA Talpaz M., Kantarjian H., Deisseroth A. RT A phosphatase activity present in peripheral blood myeloid cells of chromic RT myelogenous leukemia patients but not normal individuals alters nuclear RT protein binding to transcriptional enhancers of interferon-inducible genes RL J. Clin. Invest. 86:1664-1670 (1990). RN [4] RX MEDLINE; 91067441. RA Imam A. M. A., Ackrill A. M., Dale T. C., Kerr I. M., Stark G. R. RT Transcription factors induced by interferons alpha and gamma RL Nucleic Acids Res. 18:6573-6580 (1990). RN [5] RX MEDLINE; 89145211. RA Dale T. C., Ali Imam A. M., Kerr I. M., Stark G. R. RT Rapid activation by interferon alpha of a latent DNA-binding protein RT present in the cytoplasm of untreated cells RL Proc. Natl. Acad. Sci. USA 86:1203-1207 (1989). XX // AC R00004 XX ID AD2$IVA2_01 XX DT 20.06.1990 (created); ewi. DT 17.10.2001 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE IVa2 promoter; Gene: G000009. XX SQ ACCCCTCCCACTT. XX EL PPE XX SF -50 ST -36 XX BF T00759; Sp1; Quality: 4; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM competitive DNAse I footprint MM direct gel shift XX CC element identical in adenovirus type 5 and 2, both are proven experimentally XX DR EMBL: X02996; AD5001 (-5888:-5876). DR EMBL: J01917; HACG (-5878:-5866). XX RN [1] RX MEDLINE; 92269862. RA Kasai Y., Chen H., Flint S. J. RT Anatomy of an unusual RNA polymerase II promoter containing a downstream RT TATA element RL Mol. Cell. Biol. 12:2884-2897 (1992). RN [2] RX MEDLINE; 91224350. RA Tamura T.-A., Mikoshiba K. RT Role of a GC-rich motif in transcription regulation of the adenovirus type RT 2 IVa2 promoter which lacks typical TATA-box element RL FEBS Lett. 282:87-90 (1991). RN [3] RX MEDLINE; 88246423. RA Albrecht G., Devaux B., Kedinger C. RT Genomic Footprinting Detects Factors Bound to Major Late and IVa2 Promoters RT in Adenovirus-Infected HeLa Cells RL Mol. Cell. Biol. 8:1534-1539 (1988). XX // AC R00005 XX ID HS$4F2H_01 XX DT 20.06.1990 (created); ewi. DT 16.08.2001 (updated); rio. CO Copyright (C), Biobase GmbH. XX TY D XX DE 4F2HC (4F2 heavy chain); Gene: G000174. XX SQ CTCCTTTCTTTGAAG. XX BF T00569; NF-4FA; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0123; Jurkat XX MM DNase I footprinting MM gel retardation XX DR EMBL: M21898; HS4F2HG1 (1808:1822). XX RN [1] RX MEDLINE; 89343976. RA Karpinski B. A., Yang L.-H., Cacheris P., Morle G. D., Leiden J. M. RT The First Intron of the 4F2 Heavy-Chain Gene Contains a Transcriptional RT Enhancer Element That Binds Multiple Nuclear Proteins RL Mol. Cell. Biol. 9:2588-2597 (1989). XX // AC R00006 XX ID HS$4F2H_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE 4F2HC (4F2 heavy chain); Gene: G000174. XX SQ CTCCGTCACGAGGGTGG. XX BF T00571; NF-4FC; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0123; Jurkat XX MM DNase I footprinting MM gel retardation XX DR EMBL: M21898; HS4F2HG1 (1842:1858). XX RN [1] RX MEDLINE; 89343976. RA Karpinski B. A., Yang L.-H., Cacheris P., Morle G. D., Leiden J. M. RT The First Intron of the 4F2 Heavy-Chain Gene Contains a Transcriptional RT Enhancer Element That Binds Multiple Nuclear Proteins RL Mol. Cell. Biol. 9:2588-2597 (1989). XX // AC R00007 XX ID HS$4F2H_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE 4F2HC (4F2 heavy chain); Gene: G000174. XX SQ GTGACTCA. XX BF T00133; c-Jun; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0123; Jurkat XX MM DNase I footprinting MM gel retardation XX DR EMBL: M21898; HS4F2HG1 (1859:1866). XX RN [1] RX MEDLINE; 89343976. RA Karpinski B. A., Yang L.-H., Cacheris P., Morle G. D., Leiden J. M. RT The First Intron of the 4F2 Heavy-Chain Gene Contains a Transcriptional RT Enhancer Element That Binds Multiple Nuclear Proteins RL Mol. Cell. Biol. 9:2588-2597 (1989). XX // AC R00008 XX ID HS$4F2H_04 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE 4F2HC (4F2 heavy chain); Gene: G000174. XX SQ AGAAGCCAGTTGCAACCGGTTTCTG. XX BF T00570; NF-4FB; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0123; Jurkat XX MM DNase I footprinting MM gel retardation XX DR EMBL: M21898; HS4F2HG1 (1890:1914). XX RN [1] RX MEDLINE; 89343976. RA Karpinski B. A., Yang L.-H., Cacheris P., Morle G. D., Leiden J. M. RT The First Intron of the 4F2 Heavy-Chain Gene Contains a Transcriptional RT Enhancer Element That Binds Multiple Nuclear Proteins RL Mol. Cell. Biol. 9:2588-2597 (1989). XX // AC R00009 XX ID CAMV$35SR_01 XX DT 20.06.1990 (created); ewi. DT 13.09.2001 (updated); rge. CO Copyright (C), Biobase GmbH. XX TY D XX DE 35S RNA; Gene: G000041. XX SQ cTGACGtaagggaTGACGcac. XX EL as-1 XX SF -83 ST -63 XX BF T04851; ASF-1; Quality: 0; Species: tobacco, Nicotiana tabacum. BF T02659; OBF4; Quality: 2; Species: thale cress, Arabidopsis thaliana. BF T02661; OBF5; Quality: 2; Species: thale cress, Arabidopsis thaliana. BF T04853; SARP; Quality: 4; Species: tobacco, Nicotiana tabacum. BF T02794; TGA1; Quality: 2; Species: thale cress, Arabidopsis thaliana. BF T00829; TGA1a; Quality: 4; Species: tobacco, Nicotiana tabacum. BF T00830; TGA1b; Quality: 2; Species: tobacco, Nicotiana tabacum. BF T02795; TGA2; Quality: 2; Species: thale cress, Arabidopsis thaliana. BF T04757; TGA2.1; Quality: 2; Species: tobacco, Nicotiana tabacum. BF T04758; TGA2.2; Quality: 2; Species: tobacco, Nicotiana tabacum. BF T02796; TGA3; Quality: 2; Species: thale cress, Arabidopsis thaliana. BF T02797; TGA6; Quality: 2; Species: thale cress, Arabidopsis thaliana. BF T03722; ZAP1; Quality: 2; Species: thale cress, Arabidopsis thaliana. XX OS CaMV, cauliflower mosaic virus OC viridae; ds-DNA nonenveloped viruses; caulimovirus XX SO 0299; rec(tobacco-E.coli) SO 0381; tobacco SO 0521; rec(Arabidopsis-ret lys) SO 0531; rec(A.thaliana-E.coli) XX MM DNase I footprinting MM direct gel shift MM supershift (antibody binding) MM gel shift competition XX CC TGA2 and TGA5 (OBF5), but not TGA1 and TGA3, showed cooperation in binding CC to the two tandem TGACG motifs [5]; the apparent affinity of TGA1 for the CC site is ca. 2-fold lower than TGA2, TGA3, TGA5 [5]; no significant binding CC of GBF1 [5] XX DR EMBL: X14911; CAMVI (2380:2400). XX RN [1] RX MEDLINE; 20267446. RA Niggeweg R., Thurow C., Weigel R., Pfitzner U., Gatz C. RT Tobacco TGA factors differ with respect to interaction with NPR1, RT activation potential and DNA-binding properties RL Plant Mol. Biol. 42:775-788 (2000). RN [2] RX MEDLINE; 97369364. RA Xiang C., Miao Z., Lam E. RT DNA-binding properties, genomic organization and expression pattern of RT TGA6, a new member of the TGA family of bZIP transcription factors in RT Arabidopsis thaliana. RL Plant Mol. Biol. 34:403-415 (1997). RN [3] RX MEDLINE; 96188845. RA de Pater S., Pham K., Memelink J., Kijne J. RT Binding specificity and tissue-specific expression pattern of the RT Arabidopsis bZIP transcription factor TGA2. RL Mol. Gen. Genet. 250:237-239 (1996). RN [4] RX MEDLINE; 97128253. RA de Pater S., Greco V., Pham K., Memelink J., Kijne J. RT Characterization of a zinc-dependent transcriptional activator from RT Arabidopsis RL Nucleic Acids Res. 24:4624-4631 (1996). RN [5] RX MEDLINE; 96017785. RA Lam E., Lam Y. K.-P. RT Binding site requirements and differential representation of TGA factors in RT nuclear ASF-1 activity RL Nucleic Acids Res. 23:3778-3785 (1995). RN [6] RX MEDLINE; 94272006. RA Miao Z.-H., Liu X., Lam E. RT TGA3 is a distinct member of the TGA family of bZIP transcription factors RT in Arabidopsis thaliana. RL Plant Mol. Biol. 25:1-11 (1994). RN [7] RX MEDLINE; 93076114. RA Schindler U., Beckmann H., Cashmore A. R. RT TGA1 and G-box binding factors: two distinct classes of Arabidopsis leucine RT zipper proteins compete for the G-box-like element TGACGTGG. RL Plant Cell 4:1309-1319 (1992). RN [8] RX MEDLINE; 90384943. RA Yamazaki K.-I., Katagiri F., Imaseki H., Chua N.-H. RT TGA1a, a tobacco DNA-binding protein, increases the rate of initiation in a RT plant in vitro transcription system RL Proc. Natl. Acad. Sci. USA 87:7035-7039 (1990). RN [9] RX MEDLINE; 90277686. RA Lam E., Katagiri F., Chua N.-H. RT Plant nuclear factor ASF-1 binds to an essential region of the nopaline RT synthase promoter RL J. Biol. Chem. 265:9909-9913 (1990). RN [10] RX MEDLINE; 89365179. RA Katagiri F., Lam E., Chua N.-H. RT Two tobacco DNA-binding proteins with homology to the nuclear factor CREB RL Nature 340:727-729 (1989). RN [11] RX MEDLINE; 89365179. RA Katagiri F., Lam E., Chua N.-H. RT Two tobacco DNA-binding proteins with homology to the nuclear factor CREB RL Nature 340:727-730 (1989). RN [12] RX MEDLINE; 90046702. RA Lam E., Benfey P. N., Gilmartin P. M., Fang R.-X., Chua N.-H. RT Site-specific mutations alter in vitro factor binding and change promoter RT expression patterns in transgenic plants RL Proc. Natl. Acad. Sci. USA 86:7890-7894 (1989). XX // AC R00010 XX ID HS$A4_01 XX DT 20.06.1990 (created); ewi. DT 31.05.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE APP (A4 amyloid precursor protein); Gene: G000180. XX SQ GGGCGCgGG. XX SF -200 ST -100 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM gel retardation XX DR EMBL: M34862; HSAMYB01 (688:696). DR EMBL: M24546; HSAPPB01 (752:760). DR EMBL: X12751; HSPADP (3554:3562). XX RN [1] RX MEDLINE; 89030646. RA Salbaum J. M., Weidemann A., Lemaire H.-G., Maters C. L., Beyreuther K. RT The promoter of Alzheimer's disease amyloid A4 precursor gene RL EMBO J. 7:2807-2813 (1988). XX // AC R00011 XX ID CHICK$ACRA_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE AChR alpha (acetylcholine receptor, alpha-subunit); Gene: G000042. XX EL ARI XX SF -132 ST -123 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX MM DNase I footprinting XX RN [1] RX MEDLINE; 89251598. RA Piette J., Klarsfeld A., Changeux J.-P. RT Interaction of nuclear factors with the upstream region of the RT alpha-subunit gene of chicken muscle acetylcholine receptor: variations RT with muscle differentiation and denervation RL EMBO J. 8:687-694 (1989). XX // AC R00012 XX ID CHICK$ACRA_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AChR alpha (acetylcholine receptor, alpha-subunit); Gene: G000042. XX SQ CCTCAGCTGTCATGC. XX EL ARIIp XX SF -110 ST -96 XX BF T00526; MyoD; Quality: 6; Species: mouse, Mus musculus. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0303; rec(mouse-E.coli) XX MM DNase I footprinting MM methylation interference XX DR EMBL: AF051909; AF051909 (756:770). DR EPD: EP15042; GG_ACHA. XX RN [1] RX MEDLINE; 90259076. RA Piette J., Bessereau J.-L., Huchet M., Changeux J.-P. RT Two adjacent MyoD1-binding sites regulate expression of the acetylcholine RT receptor alpha-subunit gene RL Nature 345:353-358 (1990). XX // AC R00013 XX ID CHICK$ACRA_03 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE AChR alpha (acetylcholine receptor, alpha-subunit); Gene: G000042. XX EL ARIIa XX SF -98 ST -90 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX MM DNase I footprinting XX RN [1] RX MEDLINE; 89251598. RA Piette J., Klarsfeld A., Changeux J.-P. RT Interaction of nuclear factors with the upstream region of the RT alpha-subunit gene of chicken muscle acetylcholine receptor: variations RT with muscle differentiation and denervation RL EMBO J. 8:687-694 (1989). XX // AC R00014 XX ID CHICK$ACRA_04 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AChR alpha (acetylcholine receptor, alpha-subunit); Gene: G000042. XX SQ ACAGGTGGTGTAAGGCA. XX EL ARIIb XX SF -91 ST -74 XX BF T00526; MyoD; Quality: 6; Species: mouse, Mus musculus. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0303; rec(mouse-E.coli) XX MM DNase I footprinting MM methylation interference XX DR EMBL: AF051909; AF051909 (776:792). DR EPD: EP15042; GG_ACHA. DR TRANSCOMPEL: C00027. XX RN [1] RX MEDLINE; 90259076. RA Piette J., Bessereau J.-L., Huchet M., Changeux J.-P. RT Two adjacent MyoD1-binding sites regulate expression of the acetylcholine RT receptor alpha-subunit gene RL Nature 345:353-358 (1990). XX // AC R00015 XX ID CHICK$ACRA_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AChR alpha (acetylcholine receptor, alpha-subunit); Gene: G000042. XX SQ GTGGTGT. XX EL ARIIb XX SF -87 ST -79 XX BF T00601; NF-1 (-like proteins); Quality: 5; Species: chick, Gallus gallus. BF T00755; Sp1; Quality: 5; Species: chick, Gallus gallus. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX MM DNase I footprinting MM gel retardation XX DR EMBL: AF051909; AF051909 (780:786). DR EPD: EP15042; GG_ACHA. XX RN [1] RX MEDLINE; 89251598. RA Piette J., Klarsfeld A., Changeux J.-P. RT Interaction of nuclear factors with the upstream region of the RT alpha-subunit gene of chicken muscle acetylcholine receptor: variations RT with muscle differentiation and denervation RL EMBO J. 8:687-694 (1989). XX // AC R00016 XX ID CHICK$ACRA_06 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE AChR alpha (acetylcholine receptor, alpha-subunit); Gene: G000042. XX SQ GCAAT. XX EL ARIIc XX SF -76 ST -68 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX MM DNase I footprinting XX DR EMBL: AF051909; AF051909 (790:794). DR EPD: EP15042; GG_ACHA. XX RN [1] RX MEDLINE; 89251598. RA Piette J., Klarsfeld A., Changeux J.-P. RT Interaction of nuclear factors with the upstream region of the RT alpha-subunit gene of chicken muscle acetylcholine receptor: variations RT with muscle differentiation and denervation RL EMBO J. 8:687-694 (1989). XX // AC R00017 XX ID CHICK$ACRA_07 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AChR alpha (acetylcholine receptor, alpha-subunit); Gene: G000042. XX SQ CCGCCC. XX EL ARIII XX SF -60 ST -38 XX BF T00755; Sp1; Quality: 1; Species: chick, Gallus gallus. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX MM DNase I footprinting MM gel retardation MM methylation interference XX CC conflict: GGACHRA(258:) is AAAAGCCC instead of ccCCGCCC XX DR TRANSCOMPEL: C00010. DR TRANSCOMPEL: C00027. XX RN [1] RX MEDLINE; 89251598. RA Piette J., Klarsfeld A., Changeux J.-P. RT Interaction of nuclear factors with the upstream region of the RT alpha-subunit gene of chicken muscle acetylcholine receptor: variations RT with muscle differentiation and denervation RL EMBO J. 8:687-694 (1989). XX // AC R00018 XX ID MOUSE$ACRD_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AChR delta (acetylcholine receptor, delta-subunit); Gene: G000457. XX SQ TGCCTGG. SQ TGCCCTTG. SQ TGCCCTAA. SQ TGGCAAAC. XX SF -148 ST -95 XX BF T00528; myogenin; Quality: 6; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0042; C2 myoblasts XX MM gel retardation XX DR EMBL: X13959; MMACHR (1265:1272). DR EMBL: X13959; MMACHR (1278:1285). DR EMBL: M36684; MMACHRDA (1265:1272). DR EMBL: M36684; MMACHRDA (1278:1285). XX RN [1] RX MEDLINE; 90015215. RA Baldwin T. J., Burden S. J. RT Muscle-specific gene expression controlled by a regulatory element lacking RT a MyoD1-binding site RL Nature 341:716-720 (1989). XX // AC R00019 XX ID MOUSE$ACRD_02 XX DT 20.06.1990 (created); ewi. DT 12.11.1997 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AChR delta (acetylcholine receptor, delta-subunit); Gene: G000457. XX SQ ccaccagCACCTGtc. XX EL E1 XX SF -29 ST -15 XX BF T01786; E12; Quality: 6; Species: mouse, Mus musculus. BF T01788; E47; Quality: 6; Species: mouse, Mus musculus. BF T00526; MyoD; Quality: 6; Species: mouse, Mus musculus. BF T00528; myogenin; Quality: 6; Species: mouse, Mus musculus. XX MX M00693; V$E12_Q6 MX M00712; V$MYOGENIN_Q6 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0042; C2 myoblasts SO 0303; rec(mouse-E.coli) SO 0873; C2 myotubes XX MM functional analysis MM gel retardation MM direct gel shift MM methylation interference MM ethylation interference XX CC MyoD and myogenin bind as heterodimers with either E12 or E47 [1] XX DR EMBL: X13959; MMACHR (1364:1378). DR EMBL: M36684; MMACHRDA (1364:1378). XX RN [1] RX MEDLINE; 93360949. RA Simon A. M., Burden S. J. RT An E box mediates activation and repression of the acetylcholine receptor RT delta-subunit gene during myogenesis RL Mol. Cell. Biol. 13:5133-5140 (1993). RN [2] RX MEDLINE; 90015215. RA Baldwin T. J., Burden S. J. RT Muscle-specific gene expression controlled by a regulatory element lacking RT a MyoD1-binding site RL Nature 341:716-720 (1989). XX // AC R00020 XX ID Y$ACT1_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ACT1 (actin); Gene: G000868. XX SQ atttctCTGTCACCGgcctc. XX SF -29 ST -15 XX BF T00725; REB1; Quality: 1; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM direct gel shift MM nitrocellulose filter binding XX CC conflict: SCACT (257:276) ends...ccCgGcCT XX DR EMBL: L00026; SCACT (257:276). XX RN [1] RX MEDLINE; 90299123. RA Chasman D. I., Lue N. F., Buchman A. R., LaPointe J. W., Lorch Y., Kornberg RA R. D. RT A yeast protein that influences the chromatin structure of UASG and RT functions as a powerful auxiliary gene activator RL Genes Dev. 4:503-514 (1990). XX // AC R00021 XX ID HS$AAC_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CA-ACT (cardiac alpha-actin); Gene: G000193. XX SQ CCATGAATGG. SQ CCAAATAAGG. XX SF -177 ST -48 XX BF T00765; SRF (504 AA); Quality: 4; Species: mouse, Mus musculus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0042; C2 myoblasts SO 0435; Ltk- XX MM gel retardation XX DR EMBL: M13483; HSACTCA (337:346). DR EMBL: M13483; HSACTCA (377:386). DR EPD: EP16033; HS_ACTC. XX RN [1] RX MEDLINE; 89093119. RA Boxer L. M., Miwa T., Gustafson T. A., Kedes L. RT Identification and Characterization of a Factor That Binds to Two Human RT Sarcomeric Actin Promoters RL J. Biol. Chem. 264:1284-1292 (1989). RN [2] RX MEDLINE; 88016159. RA Miwa T., Boxer L. M., Kedes L. RT CArG boxes in the human cardiac alpha-actin gene are core binding sites for RT positive trans-acting regulatory factors RL Proc. Natl. Acad. Sci. USA 84:6702-6706 (1987). XX // AC R00022 XX ID HS$AAC_02 XX DT 20.06.1990 (created); ewi. DT 06.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CA-ACT (cardiac alpha-actin); Gene: G000193. XX SQ CCATGAATGG. XX SF -177 ST -136 XX BF T00083; CBF (2); Quality: 6; Species: mouse, Mus musculus. BF T00765; SRF (504 AA); Quality: 4; Species: mouse, Mus musculus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0003; 3T3 SO 0042; C2 myoblasts SO 0069; F9 XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR EMBL: M13483; HSACTCA (337:346). DR EPD: EP16033; HS_ACTC. XX RN [1] RX MEDLINE; 89093119. RA Boxer L. M., Miwa T., Gustafson T. A., Kedes L. RT Identification and Characterization of a Factor That Binds to Two Human RT Sarcomeric Actin Promoters RL J. Biol. Chem. 264:1284-1292 (1989). RN [2] RX MEDLINE; 90014780. RA Gustafson T. A., Kedes L. RT Identification of Multiple Proteins That Interact with Functional Regions RT of the Human Cardiac alpha-Actin Promoter RL Mol. Cell. Biol. 9:3269-3283 (1989). XX // AC R00023 XX ID HS$AAC_03 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE CA-ACT (cardiac alpha-actin); Gene: G000193. XX SQ TAGCGGGTG. XX SF -127 ST -119 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0042; C2 myoblasts XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR EMBL: M13483; HSACTCA (359:367). DR EPD: EP16033; HS_ACTC. XX RN [1] RX MEDLINE; 89039835. RA Gustafson T. A., Miwa T., Boxer L. M., Kedes L. RT Interactions of Nuclear Proteins with Muscle-Specific Regulatory Sequences RT of the Human Cardiac alpha-Actin Promoter RL Mol. Cell. Biol. 8:4110-4119 (1988). XX // AC R00024 XX ID HS$AAC_04 XX DT 20.06.1990 (created); ewi. DT 28.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CA-ACT (cardiac alpha-actin); Gene: G000193. XX SQ CCAAATAAGG. XX SF -117 ST -92 XX BF T00764; SRF; Quality: 1; Species: human, Homo sapiens. BF T00765; SRF (504 AA); Quality: 1; Species: mouse, Mus musculus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0042; C2 myoblasts SO 0100; HeLa SO 0135; L XX MM gel retardation XX DR TRANSPATH: XN000014291 DR EMBL: M13483; HSACTCA (377:386). DR EPD: EP16033; HS_ACTC. XX RN [1] RX MEDLINE; 90294287. RA Tuil D., Clergue N., Montarras D., Pinset Ch., Kahn A., Phan-Dinh-Tuy F. RT CC Ar GG boxes, cis-acting elements with a dual specificity: RT Muscle-specific transcriptional activation and serum responsiveness RL J. Mol. Biol. 213:677-686 (1990). RN [2] RX MEDLINE; 89219044. RA Boxer L. M., Prywes R., Roeder R. G., Kedes L. RT The Sarcomeric Actin CArG-Binding Factor Is Indistinguishable from the RT c-fos Serum Response Factor RL Mol. Cell. Biol. 9:515-522 (1989). RN [3] RX MEDLINE; 90014780. RA Gustafson T. A., Kedes L. RT Identification of Multiple Proteins That Interact with Functional Regions RT of the Human Cardiac alpha-Actin Promoter RL Mol. Cell. Biol. 9:3269-3283 (1989). RN [4] RX MEDLINE; 89184588. RA Gustafson T. A., Taylor A., Kedes L. RT DNA bending is induced by a transcription factor that interacts with the RT human c-FOS and alpha-actin promoters RL Proc. Natl. Acad. Sci. USA 86:2162-2166 (1989). XX // AC R00026 XX ID HS$AAC_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CA-ACT (cardiac alpha-actin); Gene: G000193. XX SQ CCAAATAAGG. XX SF -113 ST -84 XX BF T00765; SRF (504 AA); Quality: 4; Species: mouse, Mus musculus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0003; 3T3 SO 0042; C2 myoblasts SO 0069; F9 XX MM gel retardation XX DR EMBL: M13483; HSACTCA (377:386). DR EPD: EP16033; HS_ACTC. XX RN [1] RX MEDLINE; 89093119. RA Boxer L. M., Miwa T., Gustafson T. A., Kedes L. RT Identification and Characterization of a Factor That Binds to Two Human RT Sarcomeric Actin Promoters RL J. Biol. Chem. 264:1284-1292 (1989). XX // AC R00027 XX ID HS$AAC_06 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CA-ACT (cardiac alpha-actin); Gene: G000193. XX SQ CCAAATAAGG. XX SF -110 ST -99 XX BF T00765; SRF (504 AA); Quality: 4; Species: mouse, Mus musculus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0042; C2 myoblasts SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR EMBL: M13483; HSACTCA (377:386). DR EPD: EP16033; HS_ACTC. XX RN [1] RX MEDLINE; 89039835. RA Gustafson T. A., Miwa T., Boxer L. M., Kedes L. RT Interactions of Nuclear Proteins with Muscle-Specific Regulatory Sequences RT of the Human Cardiac alpha-Actin Promoter RL Mol. Cell. Biol. 8:4110-4119 (1988). XX // AC R00028 XX ID HS$AAC_07 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE CA-ACT (cardiac alpha-actin); Gene: G000193. XX SQ CCAAATAAGGC. XX SF -109 ST -99 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0043; C2C12 XX MM gel retardation MM methylation interference XX DR EMBL: M13483; HSACTCA (377:387). DR EPD: EP16033; HS_ACTC. XX RN [1] RX MEDLINE; 88225064. RA Phan-Dinh-Tuy F., Tuil D., Schweighoffer F., Pinset C., Kahn A., Minty A. RT The 'CC.Ar.GG' box: A protein-binding site common to RT transcription-regulatory regions of the cardiac actin, c-fos and RT interleukin-2 receptor genes RL Eur. J. Biochem. 173:507-515 (1988). XX // AC R00029 XX ID CHICK$AAC_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE SA-ACT (skeletal alpha-actin); Gene: G000044. XX SF -148 ST -12 XX BF T00915; YY1; Quality: 1; Species: human, Homo sapiens. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0100; HeLa XX MM gel retardation XX RN [1] RX MEDLINE; 88246451. RA Walsh K., Schimmel P. RT DNA-binding site for two skeletal actin promoter factors is important for RT expression in muscle cells RL Mol. Cell. Biol. 8:1800-1802 (1988). XX // AC R00030 XX ID CHICK$AAC_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE SA-ACT (skeletal alpha-actin); Gene: G000044. XX SF -148 ST -12 XX BF T00483; MAPF2; Quality: 1; Species: rat, Rattus norvegicus. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0137; L6 XX MM gel retardation XX DR TRANSPATH: XN000007637 XX RN [1] RX MEDLINE; 88246451. RA Walsh K., Schimmel P. RT DNA-binding site for two skeletal actin promoter factors is important for RT expression in muscle cells RL Mol. Cell. Biol. 8:1800-1802 (1988). XX // AC R00031 XX ID CHICK$AAC_03 XX DT 20.06.1990 (created); ewi. DT 13.11.2000 (updated); dkl. CO Copyright (C), Biobase GmbH. XX TY D XX DE SA-ACT (skeletal alpha-actin); Gene: G000044. XX SQ gcccgacacCCAAATATGGcgac. XX EL MRE; SRE1 XX SF -91 ST -81 XX BF T00507; MF3; Quality: 1; Species: chick, Gallus gallus. BF T00761; SRF; Quality: 1; Species: chick, Gallus gallus. BF T00764; SRF; Quality: 1; Species: human, Homo sapiens. BF T00766; SRF; Quality: 3; Species: rat, Rattus norvegicus. BF T00915; YY1; Quality: 1; Species: human, Homo sapiens. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0003; 3T3 SO 0095; H9 SO 0100; HeLa SO 0306; rec(human-E.coli) SO 0372; skeletal muscle SO 0857; cardiac myocytes SO 1128; cardiac muscle XX MM affinity chromatography MM DNase I footprinting MM direct gel shift MM supershift (antibody binding) MM gel shift competition MM methylation interference MM ethylation protection XX CC SRF level increases with myoblast differentiation; mutation of nucleotides CC adjacent to the site given in capital letters abolish either SRF (5') or CC YY1 (3') binding [2] XX DR TRANSPATH: XN000007668 DR TRANSPATH: XN000008076 DR TRANSPATH: XN000008089 DR TRANSPATH: XN000008336 DR TRANSPATH: XN000014292 DR EMBL: M13631; GGACAREG (165:185). DR TRANSCOMPEL: C00008. XX RN [1] RX MEDLINE; 96299437. RA Croissant J.D., Kim J.H., Eichele G., Goering L., Lough J., Prywes R., RA Schwartz R.J. RT Avian serum response factor expression restricted primarily to muscle cell RT lineages is required for alpha-actin gene transcription RL Dev. Biol. 177:250-264 (1996). RN [2] RX MEDLINE; 94266892. RA MacLellan W. R., Lee T.-C., Schwartz R. J., Schneider M. D. RT Transforming growth factor-beta response elements of the skeletal RT alpha-actin gene RL J. Biol. Chem. 269:16754-16760 (1994). RN [3] RX MEDLINE; 93028553. RA Lee T.-C., Shi Y., Schwartz R. J. RT Displacement of BrdUrd-induced YY1 by serum response factor activates RT skeletal alpha-actin transcription in embryonic myoblasts RL Proc. Natl. Acad. Sci. USA 89:9814-9818 (1992). RN [4] RX MEDLINE; 92017784. RA Lee T.-C., Chow K.-L., Fang P., Schwartz R. J. RT Activation of skeletal alpha-actin gene transcription: the cooperative RT formation of serum response factor-binding complexes over positive RT cis-acting promoter serum response elements displaces a negative-acting RT nuclear factor enriched in replicating a RL Mol. Cell. Biol. 11:5090-5100 (1991). RN [5] RX MEDLINE; 91172180. RA Santoro I. M., Yi T.-M., Walsh K. RT Identification of single-stranded-DNA-binding proteins that interact with RT muscle gene elements RL Mol. Cell. Biol. 11:1944-1953 (1991). RN [6] RX MEDLINE; 90318394. RA Mar J. H., Ordahl Ch. P. RT M-CAT Binding Factor, a Novel trans-Acting Factor Governing Muscle-Specific RT Transcription RL Mol. Cell. Biol. 10:4271-4283 (1990). RN [7] RX MEDLINE; 89313766. RA Walsh K. RT Cross-Binding of Factors to Functionally Different Promoter Elements in RT c-fos and Skeletal Actin Genes RL Mol. Cell. Biol. 9:2191-2201 (1989). XX // AC R00034 XX ID CHICK$AAC_06 XX DT 20.06.1990 (created); ewi. DT 17.03.1998 (updated); ili. CO Copyright (C), Biobase GmbH. XX TY D XX DE SA-ACT (skeletal alpha-actin); Gene: G000044. XX SQ ccaaatatGGCGACggccgggg. XX SF -83 ST -78 XX BF T00278; delta factor; Quality: 4; Species: mouse, Mus musculus. BF T00275; F-ACT1; Quality: 5; Species: chick, Gallus gallus. BF T00483; MAPF2; Quality: 2; Species: rat, Rattus norvegicus. BF T00943; MAPF2; Quality: 5; Species: mouse, Mus musculus. BF T00915; YY1; Quality: 2; Species: human, Homo sapiens. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0043; C2C12 SO 0048; CEF SO 0100; HeLa SO 0137; L6 SO 0275; HC11 SO 0404; embryo muscle XX MM direct gel shift MM gel shift competition MM methylation interference XX CC F-ACT1 = YY-1 competes with SRF and represses basal expression; KD(YY-1)= CC 6.8 nM; KD(SRF)= 5.8 nM; YY-1 binding decreases with myoblast CC differentiation XX DR TRANSPATH: XN000007420 DR TRANSPATH: XN000007428 DR TRANSPATH: XN000007637 DR TRANSPATH: XN000008336 DR TRANSPATH: XN000008356 DR EMBL: M13631; GGACAREG (174:195). DR TRANSCOMPEL: C00008. XX RN [1] RX MEDLINE; 94158847. RA Raught B., Khursheed B., Kazansky A., Rosen J. RT YY1 represses beta-casein gene expression by preventing the formation of a RT lactation-associated complex RL Mol. Cell. Biol. 14:1752-1763 (1994). RN [2] RX MEDLINE; 92375089. RA Gualberto A., LePage D., Pons G., Mader S. L., Park K., Atchison M. L., RA Walsh K. RT Functional antagonism between YY1 and the serum response factor RL Mol. Cell. Biol. 12:4209-4214 (1992). RN [3] RX MEDLINE; 93028553. RA Lee T.-C., Shi Y., Schwartz R. J. RT Displacement of BrdUrd-induced YY1 by serum response factor activates RT skeletal alpha-actin transcription in embryonic myoblasts RL Proc. Natl. Acad. Sci. USA 89:9814-9818 (1992). RN [4] RX MEDLINE; 92017784. RA Lee T.-C., Chow K.-L., Fang P., Schwartz R. J. RT Activation of skeletal alpha-actin gene transcription: the cooperative RT formation of serum response factor-binding complexes over positive RT cis-acting promoter serum response elements displaces a negative-acting RT nuclear factor enriched in replicating a RL Mol. Cell. Biol. 11:5090-5100 (1991). RN [5] RX MEDLINE; 91260723. RA Ernst H., Walsh K., Harrison C. A., Rosenthal N. RT The myosin light chain enhancer and the skeletal actin promoter share a RT binding site for factors involved in muscle-specific gene expression RL Mol. Cell. Biol. 11:3735-3744 (1991). RN [6] RX MEDLINE; 87250597. RA Walsh K., Schimmel P. RT Two Nuclear Factors Compete for the Skeletal Muscle Actin Promoter RL J. Biol. Chem. 262:9429-9432 (1987). XX // AC R00035 XX ID CHICK$AAC_07 XX DT 20.06.1990 (created); ewi. DT 09.03.1998 (updated); ili. CO Copyright (C), Biobase GmbH. XX TY D XX DE SA-ACT (skeletal alpha-actin); Gene: G000044. XX SQ ccaaatatGGCGACggccgggg. XX SF -83 ST -78 XX BF T00915; YY1; Quality: 2; Species: human, Homo sapiens. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0100; HeLa XX MM direct gel shift MM methylation interference XX CC binding of a ubiqitous factor [2] XX DR TRANSPATH: XN000008336 DR EMBL: M13631; GGACAREG (174:195). DR TRANSCOMPEL: C00008. XX RN [1] RX MEDLINE; 91260723. RA Ernst H., Walsh K., Harrison C. A., Rosenthal N. RT The myosin light chain enhancer and the skeletal actin promoter share a RT binding site for factors involved in muscle-specific gene expression RL Mol. Cell. Biol. 11:3735-3744 (1991). RN [2] RX MEDLINE; 87250597. RA Walsh K., Schimmel P. RT Two Nuclear Factors Compete for the Skeletal Muscle Actin Promoter RL J. Biol. Chem. 262:9429-9432 (1987). XX // AC R00036 XX ID HS$AACS_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE SA-ACT (skeletal alpha-actin); Gene: G000194. XX SQ ACACCCAAATATGGCTCGAG. XX SF -101 ST -81 XX BF T00765; SRF (504 AA); Quality: 4; Species: mouse, Mus musculus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0042; C2 myoblasts XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000008088 DR EMBL: M20543; HSSAACT (606:625). DR EPD: EP25005; HS_ACTS. XX RN [1] RX MEDLINE; 89093119. RA Boxer L. M., Miwa T., Gustafson T. A., Kedes L. RT Identification and Characterization of a Factor That Binds to Two Human RT Sarcomeric Actin Promoters RL J. Biol. Chem. 264:1284-1292 (1989). RN [2] RX MEDLINE; 89184588. RA Gustafson T. A., Taylor A., Kedes L. RT DNA bending is induced by a transcription factor that interacts with the RT human c-FOS and alpha-actin promoters RL Proc. Natl. Acad. Sci. USA 86:2162-2166 (1989). RN [3] RX MEDLINE; 89039836. RA Muscat G. E. O., Gustafson T. A., Kedes L. RT A Common Factor Regulates Skeletal and Cardiac alpha-Actin Gene RT Transcription in Muscle RL Mol. Cell. Biol. 8:4120-4133 (1988). XX // AC R00037 XX ID RAT$BAC_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE B-ACT (beta-actin); Gene: G000708. XX BF T00764; SRF; Quality: 5; Species: human, Homo sapiens. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa XX MM direct gel shift XX DR TRANSPATH: XN000014295 XX RN [1] RX MEDLINE; 87172790. RA Greenberg M. E., Siegfried Z., Ziff E. B. RT Mutation of the c-fos gene dyad symmetry element inhibits serum RT inducibility of transcription in vivo and the nuclear regulatory factor RT binding in vitro RL Mol. Cell. Biol. 7:1217-1225 (1987). XX // AC R00038 XX ID HS$BAC_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE B-ACT (beta-actin); Gene: G000214. XX SQ CCTTATATGG. XX SF -1492 ST -1351 XX BF T00764; SRF; Quality: 4; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM gel retardation XX DR TRANSPATH: XN000014283 DR EMBL: Y00474; HSACTBPR (583:592). XX RN [1] RX MEDLINE; 89098385. RA Frederickson R. M., Micheau M. R., Iwamoto A., Miyamoto N. G. RT 5' flanking and first intron sequences of the human beta-actin gene RT required for efficient promoter activity RL Nucleic Acids Res. 17:253-270 (1989). XX // AC R00039 XX ID HS$BAC_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE B-ACT (beta-actin); Gene: G000214. XX SQ CCAAT. SQ CCTTTTATGG. XX SF -246 ST -52 XX BF T00764; SRF; Quality: 4; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM gel retardation XX CC CCAAT is bound by an unidentified factor, CCTTTTATGG by SRF XX DR TRANSPATH: XN000014283 DR EMBL: Y00474; HSACTBPR (1922:1926). DR EPD: EP17045; HS_BACT. XX RN [1] RX MEDLINE; 89098385. RA Frederickson R. M., Micheau M. R., Iwamoto A., Miyamoto N. G. RT 5' flanking and first intron sequences of the human beta-actin gene RT required for efficient promoter activity RL Nucleic Acids Res. 17:253-270 (1989). XX // AC R00040 XX ID HS$BAC_04 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE B-ACT (beta-actin); Gene: G000214. XX SQ gTTCCGAaagttgCCTTTTATGG. XX SF 688 ST 819 XX BF T00250; Elk-1; Quality: 6; Species: human, Homo sapiens. BF T00737; SAP-1a; Quality: 6; Species: human, Homo sapiens. BF T02128; SAP-1b; Quality: 6; Species: human, Homo sapiens. BF T00764; SRF; Quality: 4; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa SO 0323; rec(human-ret lys) XX MM direct gel shift XX DR TRANSPATH: XN000005715 DR TRANSPATH: XN000005716 DR TRANSPATH: XN000005717 DR TRANSPATH: XN000014283 DR EMBL: Y00474; HSACTBPR (1937:1959). DR EPD: EP17045; HS_BACT. XX RN [1] RX MEDLINE; 93049215. RA Treisman R., Marais R., Wynne J. RT Spatial flexibility in ternary complexes between SRF and its accessory RT proteins RL EMBO J. 11:4631-4640 (1992). RN [2] RX MEDLINE; 89098385. RA Frederickson R. M., Micheau M. R., Iwamoto A., Miyamoto N. G. RT 5' flanking and first intron sequences of the human beta-actin gene RT required for efficient promoter activity RL Nucleic Acids Res. 17:253-270 (1989). XX // AC R00041 XX ID HS$BAC_05 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE B-ACT (beta-actin); Gene: G000214. XX RE 1st intron enhancer XX SQ TATGGTAAT. XX SF 751 ST 788 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX DR EMBL: M10277; HSACCYBB (941:949). XX RN [1] RX MEDLINE; 88094396. RA Kawamoto T., Makino K., Niwa H., Sugiyama H., Kimura S., Amemura M., Nakata RA A., Kakunaga T. RT Identification of the Human beta-Actin Enhancer and Its Binding Factor RL Mol. Cell. Biol. 8:267-272 (1988). XX // AC R00042 XX ID CHICK$BAC_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE B-ACT (beta-actin); Gene: G000049. XX SQ CTCCCCCCCCTCCCCACCCCC. XX SF -238 ST -218 XX BF T00270; ETF; Quality: 2; Species: human, Homo sapiens. XX MX M00695; V$ETF_Q6 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0023; A431 XX MM DNase I footprinting XX DR TRANSPATH: XN000007414 DR EMBL: X00182; GGAC01 (305:325). DR EPD: EP07061; GG_ACTB. XX RN [1] RX MEDLINE; 89359391. RA Kageyama R., Merlino G. T., Pastan I. RT Nuclear Factor ETF Specifically Stimulates Transcription from Promoters RT without a TATA Box RL J. Biol. Chem. 264:15508-15514 (1989). XX // AC R00043 XX ID CHICK$BAC_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE B-ACT (beta-actin); Gene: G000049. XX SQ CGGGGGGGGGGGGGGCG. XX SF -170 ST -154 XX BF T00270; ETF; Quality: 2; Species: human, Homo sapiens. XX MX M00695; V$ETF_Q6 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0023; A431 XX MM DNase I footprinting XX DR TRANSPATH: XN000007414 DR EMBL: X00182; GGAC01 (373:389). DR EPD: EP07061; GG_ACTB. XX RN [1] RX MEDLINE; 89359391. RA Kageyama R., Merlino G. T., Pastan I. RT Nuclear Factor ETF Specifically Stimulates Transcription from Promoters RT without a TATA Box RL J. Biol. Chem. 264:15508-15514 (1989). XX // AC R00044 XX ID CHICK$BAC_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE B-ACT (beta-actin); Gene: G000049. XX SQ CGGGGCGGGGCGGGGCG. XX SF -144 ST -128 XX BF T00270; ETF; Quality: 2; Species: human, Homo sapiens. XX MX M00695; V$ETF_Q6 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0023; A431 XX MM DNase I footprinting XX DR TRANSPATH: XN000007414 DR EMBL: X00182; GGAC01 (399:415). DR EPD: EP07061; GG_ACTB. XX RN [1] RX MEDLINE; 89359391. RA Kageyama R., Merlino G. T., Pastan I. RT Nuclear Factor ETF Specifically Stimulates Transcription from Promoters RT without a TATA Box RL J. Biol. Chem. 264:15508-15514 (1989). XX // AC R00045 XX ID CHICK$BAC_04 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE B-ACT (beta-actin); Gene: G000049. XX SQ AGGGGCGGGGCGGGGCG. XX SF -127 ST -111 XX BF T00270; ETF; Quality: 2; Species: human, Homo sapiens. XX MX M00695; V$ETF_Q6 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0023; A431 XX MM DNase I footprinting XX DR TRANSPATH: XN000007414 DR EMBL: X00182; GGAC01 (416:432). DR EPD: EP07061; GG_ACTB. XX RN [1] RX MEDLINE; 89359391. RA Kageyama R., Merlino G. T., Pastan I. RT Nuclear Factor ETF Specifically Stimulates Transcription from Promoters RT without a TATA Box RL J. Biol. Chem. 264:15508-15514 (1989). XX // AC R00046 XX ID CHICK$BAC_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE B-ACT (beta-actin); Gene: G000049. XX SQ TATAA. XX SF -30 XX BF T00270; ETF; Quality: 2; Species: human, Homo sapiens. XX MX M00695; V$ETF_Q6 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0023; A431 XX MM DNase I footprinting XX DR TRANSPATH: XN000007414 DR EMBL: X00182; GGAC01 (517:521). DR EPD: EP07061; GG_ACTB. XX RN [1] RX MEDLINE; 89359391. RA Kageyama R., Merlino G. T., Pastan I. RT Nuclear Factor ETF Specifically Stimulates Transcription from Promoters RT without a TATA Box RL J. Biol. Chem. 264:15508-15514 (1989). XX // AC R00047 XX ID DROME$AC5C_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ACT 5C (actin 5C); Gene: G000090. XX SQ TATAAAA. XX SF -38 ST -34 XX BF T00061; B factor; Quality: 6; Species: fruit fly, Drosophila melanogaster. BF T00798; TBP; Quality: 6; Species: yeast, Saccharomyces cerevisiae. XX MX M00713; F$TBP_Q6 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0300; rec(yeast-E.coli) XX MM DNase I footprinting XX DR TRANSPATH: XN000007109 DR EMBL: X06382; DM5CACT1 (697:703). DR Flybase: FBgn0000042; Act5C. XX RN [1] RX MEDLINE; 91187842. RA Kaufman P. D., Rio D. C. RT Drosophila P-element transposase is a transcriptional repressor in vitro RL Proc. Natl. Acad. Sci. USA 88:2613-2317 (1991). RN [2] RX MEDLINE; 84106841. RA Parker C. S., Topol J. RT A Drosophila RNA polymerase II transcription factor contains a RT promoter-region-specific DNA-binding activity RL Cell 36:357-369 (1984). XX // AC R00048 XX ID XENLA$AC_01 XX DT 20.06.1990 (created); ewi. DT 28.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE C-ACT (cardiac actin); Gene: G000851. XX SQ CCCTATTTGG. XX SF -227 ST -218 XX BF T00078; CArG box-binding protein; Quality: 4; Species: clawed frog, Xenopus. BF T00763; SRF; Quality: 2; Species: clawed frog, Xenopus laevis. XX OS clawed frog, Xenopus laevis OC eukaryota; animalia; metazoa; chordata; vertebrata; amphibia; lissamphibia; OC anura; archeobatrachia; pipoidea; pipidae XX SO 0319; rec(X.laevis-ret lys) SO 0382; embryos XX MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007140 DR EMBL: X04669; XLACTCAG (552:561). DR EPD: EP17044; XL_ACT1. XX RN [1] RX MEDLINE; 91184140. RA Mohun T. J., Chambers A. E., Towers N., Taylor M. V. RT Expression of genes encoding the transcription factor SRF during early RT development of Xenopus laevis: identification of a CArG box-binding RT activity as SRF RL EMBO J. 10:933-940 (1991). RN [2] RX MEDLINE; 89305517. RA Mohun T. J., Taylor M. V., Garrett N., Gurdon J. B. RT The CArG promoter sequence is necessary for muscle-specific transcription RT of the cardiac actin gene in Xenopus embryos RL EMBO J. 8:1153-1161 (1989). XX // AC R00049 XX ID XENLA$AC_02 XX DT 20.06.1990 (created); ewi. DT 28.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE C-ACT (cardiac actin); Gene: G000851. XX SQ CCATACATGG. XX SF -181 ST -172 XX BF T00078; CArG box-binding protein; Quality: 4; Species: clawed frog, Xenopus. BF T00763; SRF; Quality: 2; Species: clawed frog, Xenopus laevis. XX OS clawed frog, Xenopus laevis OC eukaryota; animalia; metazoa; chordata; vertebrata; amphibia; lissamphibia; OC anura; archeobatrachia; pipoidea; pipidae XX SO 0319; rec(X.laevis-ret lys) SO 0382; embryos XX MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007140 DR EMBL: X04669; XLACTCAG (598:607). DR EPD: EP17044; XL_ACT1. XX RN [1] RX MEDLINE; 91184140. RA Mohun T. J., Chambers A. E., Towers N., Taylor M. V. RT Expression of genes encoding the transcription factor SRF during early RT development of Xenopus laevis: identification of a CArG box-binding RT activity as SRF RL EMBO J. 10:933-940 (1991). RN [2] RX MEDLINE; 89305517. RA Mohun T. J., Taylor M. V., Garrett N., Gurdon J. B. RT The CArG promoter sequence is necessary for muscle-specific transcription RT of the cardiac actin gene in Xenopus embryos RL EMBO J. 8:1153-1161 (1989). XX // AC R00050 XX ID XENLA$AC_03 XX DT 20.06.1990 (created); ewi. DT 28.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE C-ACT (cardiac actin); Gene: G000851. XX SQ CCAAATAAGG. XX SF -90 ST -81 XX BF T00078; CArG box-binding protein; Quality: 4; Species: clawed frog, Xenopus. BF T00763; SRF; Quality: 2; Species: clawed frog, Xenopus laevis. XX OS clawed frog, Xenopus laevis OC eukaryota; animalia; metazoa; chordata; vertebrata; amphibia; lissamphibia; OC anura; archeobatrachia; pipoidea; pipidae XX SO 0319; rec(X.laevis-ret lys) SO 0382; embryos XX MM gel retardation XX DR TRANSPATH: XN000007140 DR EMBL: X04669; XLACTCAG (689:698). DR EPD: EP17044; XL_ACT1. XX RN [1] RX MEDLINE; 91184140. RA Mohun T. J., Chambers A. E., Towers N., Taylor M. V. RT Expression of genes encoding the transcription factor SRF during early RT development of Xenopus laevis: identification of a CArG box-binding RT activity as SRF RL EMBO J. 10:933-940 (1991). RN [2] RX MEDLINE; 89305517. RA Mohun T. J., Taylor M. V., Garrett N., Gurdon J. B. RT The CArG promoter sequence is necessary for muscle-specific transcription RT of the cardiac actin gene in Xenopus embryos RL EMBO J. 8:1153-1161 (1989). XX // AC R00051 XX ID XENLA$ACY_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CY-ACT (cytoskeletal actin); Gene: G000852. XX SQ AAGATgcCCAtATtTGGcgATCTT. XX EL SRE XX SF -94 ST -75 XX BF T00764; SRF; Quality: 1; Species: human, Homo sapiens. XX OS clawed frog, Xenopus laevis OC eukaryota; animalia; metazoa; chordata; vertebrata; amphibia; lissamphibia; OC anura; archeobatrachia; pipoidea; pipidae XX SO 0100; HeLa XX MM DNase I footprinting MM methylation protection MM methylation interference XX DR TRANSPATH: XN000014296 DR EMBL: M24769; XLACTIN5A (396:419). DR EMBL: M24770; XLACTIN8A (430:453). XX RN [1] RX MEDLINE; 87218526. RA Mohun T., Garrett N., Treisman R. RT Xenopus cytoskeletal actin and human c-fos gene promoters share a conserved RT protein-binding site RL EMBO J. 6:667-673 (1987). XX // AC R00052 XX ID MOUSE$APRT_01 XX DT 20.06.1990 (created); ewi. DT 30.03.1998 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE APRT (adenine phosphoribosyltransferase); Gene: G000479. XX SQ CCGCCC. SQ CCGCCC. SQ CCGCCC. XX S1 ATG SF -151 ST -76 XX BF T00752; Sp1; Quality: 5; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa XX MM DNase I footprinting MM primer extension footprint XX DR TRANSPATH: XN000008061 DR EMBL: M11310; MMAPRT (737:742). DR EMBL: M11310; MMAPRT (774:779). DR EMBL: M11310; MMAPRT (792:797). XX RN [1] RX MEDLINE; 88335604. RA Dush M. K., Briggs M. R., Royce M. E., Schaff D. A., Khan S. A., Tischfeld RA J. A., Stambrook P. J. RT Identification of DNA sequences required for mouse APRT gene expression RL Nucleic Acids Res. 16:8509-8524 (1988). XX // AC R00053 XX ID DROME$ADH_01 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE distal promoter XX SF -395 ST -360 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX MM DNase I footprinting MM methidiumpropyl-EDTA.Fe(II) in nuclei XX DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 88082682. RA Cartwright I. L. RT Developmental switch in chromatin structure associated with alternate RT promoter usage in the Drosophila melanogaster alcohol dehydrogenase gene RL EMBO J. 6:3097-3101 (1987). XX // AC R00054 XX ID DROME$ADH_02 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE distal promoter XX SF -282 ST -257 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX MM DNase I footprinting MM methidiumpropyl-EDTA.Fe(II) in nuclei XX DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 88082682. RA Cartwright I. L. RT Developmental switch in chromatin structure associated with alternate RT promoter usage in the Drosophila melanogaster alcohol dehydrogenase gene RL EMBO J. 6:3097-3101 (1987). XX // AC R00055 XX ID DROME$ADH_03 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE distal promoter XX SQ TCTCAGTGCA. XX SF -220 ST -187 XX BF T00009; Adf-2a; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX MM DNase I footprinting MM exonuclease III XX DR TRANSPATH: XN000006998 DR EMBL: Z00030; DMADHGC (4565:4574). DR EMBL: X04454; DMADHN4 (249:258). DR EPD: EP07025; DM_ADH_1. DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 90245566. RA Ewel A., Jackson J. R., Benyajati C. RT Alternative DNA-protein interactions in variable-length internucleosomal RT regions associated with Drosophila Adh distal promoter expression RL Nucleic Acids Res. 18:1771-1781 (1990). XX // AC R00056 XX ID DROME$ADH_04 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE distal promoter XX SF -143 ST -98 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX MM DNase I footprinting MM exonuclease III XX DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 90245566. RA Ewel A., Jackson J. R., Benyajati C. RT Alternative DNA-protein interactions in variable-length internucleosomal RT regions associated with Drosophila Adh distal promoter expression RL Nucleic Acids Res. 18:1771-1781 (1990). XX // AC R00057 XX ID DROME$ADH_05 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE distal promoter XX SF -120 ST -62 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX MM DNase I footprinting MM methidiumpropyl-EDTA.Fe(II) in nuclei XX DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 88082682. RA Cartwright I. L. RT Developmental switch in chromatin structure associated with alternate RT promoter usage in the Drosophila melanogaster alcohol dehydrogenase gene RL EMBO J. 6:3097-3101 (1987). XX // AC R00058 XX ID DROME$ADH_06 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE distal promoter XX SQ GCTGCtGCTGCatcCGTCGaCGTCG. XX SF -86 ST -47 XX BF T00008; Adf-1; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0131; Kc XX MM DNase I footprinting MM exonuclease III XX DR EMBL: Z00030; DMADHGC (4683:4707). DR EMBL: X04454; DMADHN4 (366:390). DR EPD: EP07025; DM_ADH_1. DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 92115725. RA England B. P., Admon A., Tjian R. RT Cloning of Drosophila transcription factor Adf-1 reveals homology to Myb RT oncoproteins RL Proc. Natl. Acad. Sci. USA 89:683-687 (1992). RN [2] RX MEDLINE; 90202990. RA England B. P., Heberlein U., Tjian R. RT Purified Drosophila Transcription Factor, Adh Distal Factor-1 (Adf-1), RT Binds to Sites in Several Drosophila Promoters and Activates Transcription RL J. Biol. Chem. 265:5086-5094 (1990). RN [3] RX MEDLINE; 90136567. RA Moses K., Heberlein U., Ashburner M. RT The Adh gene promoters of Drosophila melanogaster and Drosophila orena are RT functionally conserved and share features of sequence structure and RT nuclease-protected sites RL Mol. Cell. Biol. 10:539-548 (1990). RN [4] RX MEDLINE; 90245566. RA Ewel A., Jackson J. R., Benyajati C. RT Alternative DNA-protein interactions in variable-length internucleosomal RT regions associated with Drosophila Adh distal promoter expression RL Nucleic Acids Res. 18:1771-1781 (1990). RN [5] RX MEDLINE; 88122611. RA Heberlein U., Tjian R. RT Temporal pattern of alcohol dehydrogenase gene transcription reproduced by RT Drosophila stage-specific embryonic extracts RL Nature 331:410-415 (1988). RN [6] RX MEDLINE; 85228247. RA Heberlein U., England B., Tjian R. RT Characterization of Drosophila transcription factors that activate the RT tandem promoters of the alcohol dehydrogenase gene RL Cell 41:965-977 (1985). XX // AC R00059 XX ID DROME$ADH_07 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE distal promoter XX SQ GCCGCTGCTGCTGCA. XX SF -86 ST -77 XX BF T00008; Adf-1; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0131; Kc XX MM methidiumpropyl-EDTA.Fe(II) XX DR EMBL: Z00030; DMADHGC (4680:4694). DR EMBL: X04454; DMADHN4 (363:377). DR EPD: EP07025; DM_ADH_1. DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 90202990. RA England B. P., Heberlein U., Tjian R. RT Purified Drosophila Transcription Factor, Adh Distal Factor-1 (Adf-1), RT Binds to Sites in Several Drosophila Promoters and Activates Transcription RL J. Biol. Chem. 265:5086-5094 (1990). XX // AC R00060 XX ID DROME$ADH_08 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE distal promoter XX SQ CCGTCGACGTCGAC. XX SF -68 ST -58 XX BF T00008; Adf-1; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0131; Kc XX MM methidiumpropyl-EDTA.Fe(II) XX DR EMBL: Z00030; DMADHGC (4696:4709). DR EMBL: X04454; DMADHN4 (379:392). DR EPD: EP07025; DM_ADH_1. DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 90202990. RA England B. P., Heberlein U., Tjian R. RT Purified Drosophila Transcription Factor, Adh Distal Factor-1 (Adf-1), RT Binds to Sites in Several Drosophila Promoters and Activates Transcription RL J. Biol. Chem. 265:5086-5094 (1990). XX // AC R00061 XX ID DROME$ADH_09 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE distal promoter XX SQ TATTTAA. XX SF -36 ST -22 XX BF T00797; TBP; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX MM DNase I footprinting MM exonuclease III XX CC footprint can extend to +32 XX DR EMBL: Z00030; DMADHGC (4735:4741). DR EMBL: X04454; DMADHN4 (418:424). DR EPD: EP07025; DM_ADH_1. DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 90245566. RA Ewel A., Jackson J. R., Benyajati C. RT Alternative DNA-protein interactions in variable-length internucleosomal RT regions associated with Drosophila Adh distal promoter expression RL Nucleic Acids Res. 18:1771-1781 (1990). XX // AC R00062 XX ID DROME$ADH_10 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE distal promoter XX SF -35 ST -5 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX MM DNase I footprinting MM methidiumpropyl-EDTA.Fe(II) in nuclei XX DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 88082682. RA Cartwright I. L. RT Developmental switch in chromatin structure associated with alternate RT promoter usage in the Drosophila melanogaster alcohol dehydrogenase gene RL EMBO J. 6:3097-3101 (1987). XX // AC R00063 XX ID DROME$ADH_11 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE distal promoter XX SF -7 ST 18 XX BF T00010; Adf-2b; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX MM DNase I footprinting MM exonuclease III XX DR TRANSPATH: XN000006999 DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 90245566. RA Ewel A., Jackson J. R., Benyajati C. RT Alternative DNA-protein interactions in variable-length internucleosomal RT regions associated with Drosophila Adh distal promoter expression RL Nucleic Acids Res. 18:1771-1781 (1990). XX // AC R00064 XX ID DROME$ADH_12 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE proximal promoter XX SQ TACTAA. XX SF -269 ST -229 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0131; Kc XX MM DNase I footprinting XX CC sequence 4x XX DR EMBL: Z00030; DMADHGC (5246:5251). DR EPD: EP07024; DM_ADH_2. DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 85228247. RA Heberlein U., England B., Tjian R. RT Characterization of Drosophila transcription factors that activate the RT tandem promoters of the alcohol dehydrogenase gene RL Cell 41:965-977 (1985). XX // AC R00065 XX ID DROME$ADH_13 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE proximal promoter XX SF -167 ST -122 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX MM DNase I footprinting MM methidiumpropyl-EDTA.Fe(II) in nuclei XX DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 88082682. RA Cartwright I. L. RT Developmental switch in chromatin structure associated with alternate RT promoter usage in the Drosophila melanogaster alcohol dehydrogenase gene RL EMBO J. 6:3097-3101 (1987). XX // AC R00066 XX ID DROME$ADH_14 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE proximal promoter XX SQ GCAGCGCTGCCGTCGccggctgaGCAGC. XX SF -151 ST -105 XX BF T00008; Adf-1; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0131; Kc XX MM DNase I footprinting XX DR EMBL: Z00030; DMADHGC (5334:5361). DR EPD: EP07024; DM_ADH_2. DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 85228247. RA Heberlein U., England B., Tjian R. RT Characterization of Drosophila transcription factors that activate the RT tandem promoters of the alcohol dehydrogenase gene RL Cell 41:965-977 (1985). XX // AC R00067 XX ID DROME$ADH_15 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE proximal promoter XX SQ GCTGCCGTCGCC. SQ GCAGCCTGCGTA. XX EL p1 XX SF -138 ST -103 XX BF T00008; Adf-1; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0131; Kc XX MM DNase I footprinting XX DR EMBL: Z00030; DMADHGC (5339:5350). DR EMBL: Z00030; DMADHGC (5357:5368). DR EPD: EP07024; DM_ADH_2. DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 90202990. RA England B. P., Heberlein U., Tjian R. RT Purified Drosophila Transcription Factor, Adh Distal Factor-1 (Adf-1), RT Binds to Sites in Several Drosophila Promoters and Activates Transcription RL J. Biol. Chem. 265:5086-5094 (1990). RN [2] RX MEDLINE; 90136567. RA Moses K., Heberlein U., Ashburner M. RT The Adh gene promoters of Drosophila melanogaster and Drosophila orena are RT functionally conserved and share features of sequence structure and RT nuclease-protected sites RL Mol. Cell. Biol. 10:539-548 (1990). XX // AC R00068 XX ID DROME$ADH_16 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh (alcohol dehydrogenase); Gene: G000091. XX RE proximal promoter XX SQ GAGATCGCGTAACGGTAGATAA. XX SF -98 ST -77 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0131; Kc XX MM DNase I footprinting XX DR EMBL: Z00030; DMADHGC (5376:5397). DR EPD: EP07024; DM_ADH_2. DR Flybase: FBgn0000055; Adh. XX RN [1] RX MEDLINE; 85228247. RA Heberlein U., England B., Tjian R. RT Characterization of Drosophila transcription factors that activate the RT tandem promoters of the alcohol dehydrogenase gene RL Cell 41:965-977 (1985). XX // AC R00069 XX ID MAIZE$ADH1P_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); rge. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh1-PrF (alcohol dehydrogenase 1, PrF allele); Gene: G000439. XX SQ CGTGG. XX SF -190 ST -186 XX OS maize, Zea mays OC eukaryota; viridiplantae; embryobionta; magnoliophyta; liliopsida; OC commelinidae; cyperales; poaceae XX MM in vivo / genomic methylation protection XX DR EMBL: K03285; ZMADH1P (29:33). XX RN [1] RX MEDLINE; 87250373. RA Ferl R. J., Nick H. S. RT In Vivo Detection of Regulatory Factor Binding Sites in the 5' Flanking RT Region of Maize Adh1 RL J. Biol. Chem. 262:7947-7950 (1987). XX // AC R00070 XX ID MAIZE$ADH1P_02 XX DT 20.06.1990 (created); ewi. DT 02.05.1994 (updated); rge. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh1-PrF (alcohol dehydrogenase 1, PrF allele); Gene: G000439. XX SQ CCCCGG. XX SF -145 ST -138 XX OS maize, Zea mays OC eukaryota; viridiplantae; embryobionta; magnoliophyta; liliopsida; OC commelinidae; cyperales; poaceae XX SO 0612; maize cells XX MM in vivo / genomic methylation protection XX CC binding induced under anaerobic growth conditions XX DR EMBL: K03285; ZMADH1P (7:12). XX RN [1] RX MEDLINE; 87250373. RA Ferl R. J., Nick H. S. RT In Vivo Detection of Regulatory Factor Binding Sites in the 5' Flanking RT Region of Maize Adh1 RL J. Biol. Chem. 262:7947-7950 (1987). XX // AC R00071 XX ID MAIZE$ADH1P_03 XX DT 20.06.1990 (created); ewi. DT 02.05.1994 (updated); rge. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh1-PrF (alcohol dehydrogenase 1, PrF allele); Gene: G000439. XX SQ CGTGG. XX SF -120 ST -117 XX OS maize, Zea mays OC eukaryota; viridiplantae; embryobionta; magnoliophyta; liliopsida; OC commelinidae; cyperales; poaceae XX SO 0612; maize cells XX MM in vivo / genomic methylation protection XX CC binding induced under anaerobic growth conditions XX DR EMBL: K03285; ZMADH1P (29:33). XX RN [1] RX MEDLINE; 87250373. RA Ferl R. J., Nick H. S. RT In Vivo Detection of Regulatory Factor Binding Sites in the 5' Flanking RT Region of Maize Adh1 RL J. Biol. Chem. 262:7947-7950 (1987). XX // AC R00072 XX ID MAIZE$ADH1P_04 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); rge. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh1-PrF (alcohol dehydrogenase 1, PrF allele); Gene: G000439. XX SQ CCCACAGGC. XX SF -108 ST -100 XX OS maize, Zea mays OC eukaryota; viridiplantae; embryobionta; magnoliophyta; liliopsida; OC commelinidae; cyperales; poaceae XX MM in vivo / genomic methylation protection XX DR EMBL: K03285; ZMADH1P (42:50). XX RN [1] RX MEDLINE; 87250373. RA Ferl R. J., Nick H. S. RT In Vivo Detection of Regulatory Factor Binding Sites in the 5' Flanking RT Region of Maize Adh1 RL J. Biol. Chem. 262:7947-7950 (1987). XX // AC R00073 XX ID Y$ADH1_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Adh1 (alcohol dehydrogenase 1); Gene: G000870. XX SF -613 XX BF T00715; RAP1; Quality: 1; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM gel retardation XX RN [1] RX MEDLINE; 90136607. RA Santangelo G. M., Tornow J. RT Efficient Transcription of the Glycolytic Gene ADH1 and Three Translational RT Component Genes Requires the GCR1 Product, Which Can Act Through RT TUF/GRF/RAP Binding Sites RL Mol. Cell. Biol. 10:859-862 (1990). RN [2] RX MEDLINE; 89218968. RA Buchman A. R., Lue N. F., Kornberg R. D. RT Connections between Transcriptional Activators, Silencers, and Telomeres as RT Revealed by Functional Analysis of a Yeast DNA-Binding Protein RL Mol. Cell. Biol. 8:5086-5099 (1988). XX // AC R00074 XX ID Y$ADH2_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ADH2 (alcohol dehydrogenase 2); Gene: G000871. XX SQ TCTCC. XX SF -260 ST -253 XX BF T00011; ADR1; Quality: 1; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM methidiumpropyl-EDTA.Fe(II) XX DR EMBL: V01293; SCADR2 (887:891). XX RN [1] RX MEDLINE; 89039889. RA Eisen A., Taylor W. E., Blumberg H., Young E. T. RT The Yeast Regulatory Protein ADR1 Binds in a Zinc-Dependent Manner to the RT Upstream Activating Sequence of ADH2 RL Mol. Cell. Biol. 8:4552-4556 (1988). XX // AC R00075 XX ID Y$ADH2_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ADH2 (alcohol dehydrogenase 2); Gene: G000871. XX EL 22 bp dyad symmetry XX SF -257 ST -216 XX BF T00011; ADR1; Quality: 1; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM functional analysis XX CC deletion mutants XX RN [1] RX MEDLINE; 89343954. RA Thukral S. K., Tavianni M. A., Blumberg H., Young E. T. RT Localization of a Minimal Binding Domain and Activation Regions in Yeast RT Regulatory Protein ADR1 RL Mol. Cell. Biol. 9:2360-2369 (1989). RN [2] RX MEDLINE; 85267691. RA Beier D. R., Sledziewski A., Young E. T. RT Deletion analysis identifies a region, upstream of the ADH2 gene of RT Saccharomyces cerevisiae, which is required for ADR1-mediated derepression RL Mol. Cell. Biol. 5:1743-1749 (1985). XX // AC R00076 XX ID Y$ADH2_03 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ADH2 (alcohol dehydrogenase 2); Gene: G000871. XX SQ TCTCCAACTTATAAGTTGGAGA. XX SF -236 ST -214 XX BF T00011; ADR1; Quality: 6; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast SO 0300; rec(yeast-E.coli) SO 0349; rec(yeast-yeast) XX MM DNase I footprinting MM methidiumpropyl-EDTA.Fe(II) MM gel retardation MM methylation interference MM ethylation interference XX CC essential bases are GG(A/G)G XX DR EMBL: V01293; SCADR2 (911:932). XX RN [1] RX MEDLINE; 94254842. RA Cheng C., Kacherovsky N., Dombek K. M., Camier S., Thukral S. K., Rhim E., RA Young E. T. RT Identification of potential target genes for Adr1p through characterization RT of essential nucleotides in UAS1 RL Mol. Cell. Biol. 14:3842-3852 (1994). RN [2] RX MEDLINE; 91117235. RA Simon M., Adam G., Rapatz W., Spevak W., Ruis H. RT The Saccharomyces cerevisiae ADR1 gene is a positive regulator of RT transcription of genes encoding peroxisomal proteins RL Mol. Cell. Biol. 11:699-704 (1991). RN [3] RX MEDLINE; 91141506. RA Thukral S. K., Eisen A., Young E. T. RT Two monomers of yeast transcription factor ADR1 bind a palindromic sequence RT symmetrically to activate ADH2 expression RL Mol. Cell. Biol. 11:1566-1577 (1991). RN [4] RX MEDLINE; 89039889. RA Eisen A., Taylor W. E., Blumberg H., Young E. T. RT The Yeast Regulatory Protein ADR1 Binds in a Zinc-Dependent Manner to the RT Upstream Activating Sequence of ADH2 RL Mol. Cell. Biol. 8:4552-4556 (1988). XX // AC R00077 XX ID HS$ALBU_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ALB (albumin); Gene: G000188. XX SQ tGGTTAGtaattactaa. XX SF -363 ST -338 XX BF T00369; HNF-1; Quality: 1; Species: rat, Rattus norvegicus. BF T00368; HNF-1A; Quality: 1; Species: human, Homo sapiens. BF T01950; HNF-1B; Quality: 1; Species: human, Homo sapiens. BF T01951; HNF-1C; Quality: 1; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0103; Hep3B SO 0289; rl XX MM affinity chromatography MM DNase I footprinting MM gel retardation MM direct gel shift MM gel shift competition MM methylation interference XX DR TRANSPATH: XN000007511 DR TRANSPATH: XN000009102 DR TRANSPATH: XN000009113 DR EMBL: M13075; HSALBEX1 (695:711). DR EPD: EP16042; HS_ALBU. XX RN [1] RX MEDLINE; 90158615. RA Frain M., Hardon E., Ciliberto G., Sala-Trepat J. M. RT Binding of a liver-specific factor to the human albumin gene promoter and RT enhancer RL Mol. Cell. Biol. 10:991-999 (1990). RN [2] RX MEDLINE; 90003224. RA Frain M., Swart G., Monaci P., Nicosia A., Staempfli S., Frank R., Cortese RA R. RT The liver-specific transcription factor LF-B1 contains a highly diverged RT homeobox DNA binding domain RL Cell 59:145-157 (1989). XX // AC R00078 XX ID HS$ALBU_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ALB (albumin); Gene: G000188. XX SQ TTGGCA. XX SF -136 ST -107 XX BF T00599; NF-1/L; Quality: 6; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007822 DR EMBL: M13075; HSALBEX1 (927:932). DR EPD: EP16042; HS_ALBU. XX RN [1] RX MEDLINE; 89030607. RA Paonessa G., Gounari F., Frank R., Cortese R. RT Purification of a NF1-like DNA-binding protein from rat liver and cloning RT of the corresponding cDNA RL EMBO J. 7:3115-3123 (1988). XX // AC R00079 XX ID HS$ALBU_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ALB (albumin); Gene: G000188. XX SQ TGGCA. XX SF -102 ST -79 XX BF T00599; NF-1/L; Quality: 6; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007822 DR EMBL: M13075; HSALBEX1 (959:963). DR EPD: EP16042; HS_ALBU. XX RN [1] RX MEDLINE; 89030607. RA Paonessa G., Gounari F., Frank R., Cortese R. RT Purification of a NF1-like DNA-binding protein from rat liver and cloning RT of the corresponding cDNA RL EMBO J. 7:3115-3123 (1988). XX // AC R00080 XX ID HS$ALBU_04 XX DT 20.06.1990 (created); ewi. DT 02.10.2000 (updated); rio. CO Copyright (C), Biobase GmbH. XX TY D XX DE ALB (albumin); Gene: G000188. XX RE promoter XX SQ tagTTAATAATctac. XX SF -132 ST -118 XX BF T00015; AFP1; Quality: 2; Species: human, Homo sapiens. XX MX M00616; V$AFP1_Q6 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0115; HuH-7 XX MM direct gel shift XX DR TRANSPATH: XN000007010 DR EMBL: M13075; HSALBEX1 (988:1002). DR EPD: EP16042; HS_ALBU. XX RN [1] RX MEDLINE; 89218978. RA Sawadaishi K., Morinaga T., Tamaoki T. RT Interaction of a Hepatoma-Specific Nuclear Factor with RT Transcription-Regulatory Sequences of the Human alpha-Fetoprotein and RT Albumin Genes RL Mol. Cell. Biol. 8:5179-5187 (1988). XX // AC R00081 XX ID HS$ALBU_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ALB (albumin); Gene: G000188. XX SQ TCTAGTTAATAATCTACAAT. XX SF -72 ST -42 XX BF T00369; HNF-1; Quality: 4; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation MM gel shift competition MM methylation interference XX DR EMBL: M13075; HSALBEX1 (986:1005). DR EPD: EP16042; HS_ALBU. XX RN [1] RX MEDLINE; 91092271. RA Toniatti C., Demartis A., Monaci P., Nocosia A., Ciliberto G. RT Synergistic trans-activation of the human C-reactive protein promoter by RT transcription factor HNF-1 binding at two distinct sites RL EMBO J. 9:4467-4475 (1990). RN [2] RX MEDLINE; 89005060. RA Hardon E. M., Frain M., Paonessa G., Cortese R. RT Two distinct factors interact with the promoter regions of several RT liver-specific genes RL EMBO J. 7:1711-1719 (1988). XX // AC R00082 XX ID MOUSE$ALBU_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Alb (albumin); Gene: G000464. XX SQ CTGCGTTACAGCATCCACTC. XX SF -10190 ST -10181 XX BF T00108; C/EBPalpha; Quality: 2; Species: rat, Rattus norvegicus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl SO 0678; rec(rat-) XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000005718 DR EMBL: M63182; MMALBENA (411:430). XX RN [1] RX MEDLINE; 89160814. RA Herbst R. S., Friedman N., Darnell J. E., Babiss L. E. RT Positive and negative regulatory elements in the mouse albumin enhancer RL Proc. Natl. Acad. Sci. USA 86:1553-1557 (1989). XX // AC R00083 XX ID MOUSE$ALBU_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Alb (albumin); Gene: G000464. XX SQ TGACACTACTTAACATAGG. XX SF -10150 ST -10132 XX BF T00108; C/EBPalpha; Quality: 2; Species: rat, Rattus norvegicus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl SO 0678; rec(rat-) XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000005718 DR EMBL: M63182; MMALBENA (451:469). XX RN [1] RX MEDLINE; 89160814. RA Herbst R. S., Friedman N., Darnell J. E., Babiss L. E. RT Positive and negative regulatory elements in the mouse albumin enhancer RL Proc. Natl. Acad. Sci. USA 86:1553-1557 (1989). XX // AC R00084 XX ID MOUSE$ALBU_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Alb (albumin); Gene: G000464. XX SQ CTTGGCCAGTTTTCCATGTACATGCAGAAAGAAGTTTGG. XX SF -10029 ST -9993 XX BF T00628; NLS1; Quality: 6; Species: rat, Rattus norvegicus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0059; CWSV1 SO 0100; HeLa SO 0104; HepG2 SO 0289; rl SO 0573; spleen XX MM gel retardation XX DR TRANSPATH: XN000007857 DR EMBL: M63182; MMALBENA (573:611). XX RN [1] RX MEDLINE; 89160814. RA Herbst R. S., Friedman N., Darnell J. E., Babiss L. E. RT Positive and negative regulatory elements in the mouse albumin enhancer RL Proc. Natl. Acad. Sci. USA 86:1553-1557 (1989). XX // AC R00085 XX ID MOUSE$ALBU_04 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Alb (albumin); Gene: G000464. XX SQ CTGGCTTTGTGACATT. XX SF -8750 ST -8700 XX BF T00535; NF-1; Quality: 6; Species: rat, Rattus norvegicus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM gel retardation XX DR TRANSPATH: XN000007722 XX RN [1] RX MEDLINE; 89160814. RA Herbst R. S., Friedman N., Darnell J. E., Babiss L. E. RT Positive and negative regulatory elements in the mouse albumin enhancer RL Proc. Natl. Acad. Sci. USA 86:1553-1557 (1989). XX // AC R00086 XX ID MOUSE$ALBU_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Alb (albumin); Gene: G000464. XX SQ TATTGACTTAG. XX SF -8741 ST -8724 XX BF T00371; HNF-3alpha; Quality: 6; Species: rat, Rattus norvegicus. XX MX M00724; V$HNF3ALPHA_Q6 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM gel retardation XX RN [1] RX MEDLINE; 89160814. RA Herbst R. S., Friedman N., Darnell J. E., Babiss L. E. RT Positive and negative regulatory elements in the mouse albumin enhancer RL Proc. Natl. Acad. Sci. USA 86:1553-1557 (1989). XX // AC R00087 XX ID MOUSE$ALBU_06 XX DT 20.06.1990 (created); ewi. DT 02.05.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Alb (albumin); Gene: G000464. XX SQ AAACATA. XX SF -164 ST -139 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl SO 0323; rec(human-ret lys) SO 0366; brain SO 0367; spleen XX MM DNase I footprinting MM gel retardation XX DR EMBL: M14768; MMALBPAA (16:22). XX RN [1] RX MEDLINE; 88080483. RA Lichtsteiner S., Wuarin J., Schibler U. RT The Interplay of DNA-Binding Proteins on the Promoter of the Mouse Albumin RT Gene RL Cell 51:963-973 (1987). XX // AC R00088 XX ID MOUSE$ALBU_07 XX DT 20.06.1990 (created); ewi. DT 01.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Alb (albumin); Gene: G000464. XX SQ GGGATTTAGTCAAACAACTTTTTGGCAAAGAT. XX EL pF XX SF -147 ST -113 XX BF T00535; NF-1; Quality: 6; Species: rat, Rattus norvegicus. BF T00539; NF-1; Quality: 6; Species: human, Homo sapiens. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl SO 0323; rec(human-ret lys) SO 0366; brain SO 0367; spleen XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007722 DR EMBL: M14768; MMALBPAA (28:59). XX RN [1] RX MEDLINE; 90319133. RA Zaret K. S., Liu J.-K., DiPersio C. M. RT Site-directed mutagenesis reveals a liver transcription factor essential RT for the albumin transcriptional enhancer RL Proc. Natl. Acad. Sci. USA 87:5469-5473 (1990). RN [2] RX MEDLINE; 88080483. RA Lichtsteiner S., Wuarin J., Schibler U. RT The Interplay of DNA-Binding Proteins on the Promoter of the Mouse Albumin RT Gene RL Cell 51:963-973 (1987). XX // AC R00089 XX ID MOUSE$ALBU_08 XX DT 20.06.1990 (created); ewi. DT 03.04.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Alb (albumin); Gene: G000464. XX SQ TATGATTTTGtaatggg. XX EL pD XX SF -114 ST -93 XX BF T00108; C/EBPalpha; Quality: 2; Species: rat, Rattus norvegicus. BF T00459; C/EBPbeta; Quality: 2; Species: rat, Rattus norvegicus. BF T01420; C/EBPbeta(p20); Quality: 2; Species: rat, Rattus norvegicus. BF T00216; C/EBPgamma; Quality: 2; Species: mouse, Mus musculus. BF T04875; DBP; Quality: 6; Species: human, Homo sapiens. XX MX M00622; V$CEBPGAMMA_Q6 MX M00624; V$DBP_Q6 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa SO 0103; Hep3B SO 0289; rl SO 0301; rec(rat-E.coli) SO 0350; rec(mouse-lambda) SO 0366; brain SO 0367; spleen XX MM DNase I footprinting MM copper/phenanthroline footprinting MM gel retardation MM gel shift competition MM methylation interference XX CC concentrations for shifting half of input DNA: 0.71 nM (LAP), 0.44 nM (LIP) XX DR TRANSPATH: XN000005718 DR TRANSPATH: XN000005719 DR TRANSPATH: XN000007322 DR TRANSPATH: XN000008841 DR TRANSPATH: XN000009935 DR EMBL: M14768; MMALBPAA (62:78). XX RN [1] RX MEDLINE; 92034979. RA Descombes P., Schibler U. RT A liver-enriched transcriptional activator protein, LAP, and a RT transcriptional inhibitory protein, LIP, are translated from the same mRNA RL Cell 67:569-579 (1991). RN [2] RX MEDLINE; 90235277. RA Mueller C. R., Maire P., Schibler U. RT DBP, a liver-enriched transcriptional activator, is expressed late in RT ontogeny and its tissue specificity is determined posttranscriptionally RL Cell 61:279-291 (1990). RN [3] RX MEDLINE; 91032992. RA Roman C., Platero J. S., Shuman J., Clamae K. RT Ig/EBP-1: a ubiquitously expressed immunoglobulin enhancer binding protein RT that is similar to C/EBP and heterodimerizes with C/EBP RL Genes Dev. 4:1404-1415 (1990). RN [4] RX MEDLINE; 91071582. RA Descombes P., Chojkier M., Lichtsteiner S., Falvey E., Schibler U. RT LAP, a novel member of the C/EBP gene family, encodes a liver-enriched RT transcriptional activator protein RL Genes Dev. 4:1541-1551 (1990). RN [5] RX MEDLINE; 91061771. RA Li X., Huang J. H., Rienhoff jr H. Y., Liao W. S.-L. RT Two adjacent C/EBP-binding sequences that participate in the cell-specific RT expression of the mouse serum amyloid A3 gene RL Mol. Cell. Biol. 10:6624-6631 (1990). RN [6] RX MEDLINE; 90319133. RA Zaret K. S., Liu J.-K., DiPersio C. M. RT Site-directed mutagenesis reveals a liver transcription factor essential RT for the albumin transcriptional enhancer RL Proc. Natl. Acad. Sci. USA 87:5469-5473 (1990). RN [7] RX MEDLINE; 88080483. RA Lichtsteiner S., Wuarin J., Schibler U. RT The Interplay of DNA-Binding Proteins on the Promoter of the Mouse Albumin RT Gene RL Cell 51:963-973 (1987). XX // AC R00090 XX ID MOUSE$ALBU_09 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Alb (albumin); Gene: G000464. XX SQ AACCAATGAAATG. XX SF -96 ST -69 XX BF T00108; C/EBPalpha; Quality: 2; Species: rat, Rattus norvegicus. BF T00084; CBF (2); Quality: 2; Species: rat, Rattus norvegicus. BF T00152; CP2; Quality: 6; Species: mouse, Mus musculus. BF T00613; NF-Y; Quality: 2; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa SO 0104; HepG2 SO 0262; H2.35 SO 0289; rl SO 0290; ml SO 0366; brain SO 0367; spleen SO 0674; rec XX MM DNase I footprinting MM direct gel shift XX CC binding of CP2 very weak XX DR TRANSPATH: XN000005718 DR TRANSPATH: XN000007154 DR TRANSPATH: XN000007249 DR TRANSPATH: XN000007843 DR EMBL: J00350; MMALB5E (5:17). DR EPD: EP16041; MM_ALBU. XX RN [1] RX MEDLINE; 92046085. RA Tronche F., Rollier A., Sourdive D., Cereghini S., Yaniv M. RT NFY or a related CCAAT binding factor can be replaced by other RT transcriptional activators for co-operation with HNF1 in driving the rat RT albumin promoter in vivo RL J. Mol. Biol. 222:31-43 (1991). RN [2] RX MEDLINE; 91342641. RA DiPersio C. M., Jackson D. A., Zaret K. S. RT The extracellular matrix coordinately modulates liver transcription factors RT and hepatocyte morphology RL Mol. Cell. Biol. 11:4405-4414 (1991). RN [3] RX MEDLINE; 89222448. RA Maire P., Wuarin J., Schibler U. RT The Role of Cis-Acting Promoter Elements in Tissue-Specific Albumin Gene RT Expression RL Science 244:343-346 (1989). RN [4] RX MEDLINE; 88080483. RA Lichtsteiner S., Wuarin J., Schibler U. RT The Interplay of DNA-Binding Proteins on the Promoter of the Mouse Albumin RT Gene RL Cell 51:963-973 (1987). XX // AC R00091 XX ID MOUSE$ALBU_10 XX DT 20.06.1990 (created); ewi. DT 04.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Alb (albumin); Gene: G000464. XX SQ AGTATGGTTAATGATCTACAGTT. XX EL pB XX SF -72 ST -48 XX BF T00369; HNF-1; Quality: 4; Species: rat, Rattus norvegicus. BF T00379; HP1 site factor; Quality: 6; Species: rat, Rattus norvegicus. XX MX M00725; V$HP1SITEFACTOR_Q6 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl SO 0320; rec(rat-ret lys) SO 0366; brain SO 0367; spleen XX MM DNase I footprinting MM direct gel shift MM gel shift competition MM Dam methylation XX DR TRANSPATH: XN000007530 DR EMBL: J00350; MMALB5E (25:47). DR EMBL: M14768; MMALBPAA (105:127). DR EPD: EP16041; MM_ALBU. XX RN [1] RX MEDLINE; 92046085. RA Tronche F., Rollier A., Sourdive D., Cereghini S., Yaniv M. RT NFY or a related CCAAT binding factor can be replaced by other RT transcriptional activators for co-operation with HNF1 in driving the rat RT albumin promoter in vivo RL J. Mol. Biol. 222:31-43 (1991). RN [2] RX MEDLINE; 90319133. RA Zaret K. S., Liu J.-K., DiPersio C. M. RT Site-directed mutagenesis reveals a liver transcription factor essential RT for the albumin transcriptional enhancer RL Proc. Natl. Acad. Sci. USA 87:5469-5473 (1990). RN [3] RX MEDLINE; 89288319. RA Lichtsteiner S., Schibler U. RT A Glycosylated Liver-Specific Transcription Factor Stimulates Transcription RT of the Albumin Gene RL Cell 57:1179-1187 (1989). RN [4] RX MEDLINE; 89222448. RA Maire P., Wuarin J., Schibler U. RT The Role of Cis-Acting Promoter Elements in Tissue-Specific Albumin Gene RT Expression RL Science 244:343-346 (1989). RN [5] RX MEDLINE; 88233915. RA Kugler W., Wagner U., Ryffel G. U. RT Tissue-specificity of liver gene expression: a common liver-specific RT promoter element RL Nucleic Acids Res. 16:3165-3174 (1988). RN [6] RX MEDLINE; 88080483. RA Lichtsteiner S., Wuarin J., Schibler U. RT The Interplay of DNA-Binding Proteins on the Promoter of the Mouse Albumin RT Gene RL Cell 51:963-973 (1987). XX // AC R00093 XX ID MOUSE$ALBU_11 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Alb (albumin); Gene: G000464. XX SQ ATTGGTTAAAGAA. XX SF -53 ST -32 XX BF T00108; C/EBPalpha; Quality: 2; Species: rat, Rattus norvegicus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl SO 0320; rec(rat-ret lys) SO 0366; brain SO 0367; spleen XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000005718 DR EMBL: J00350; MMALB5E (48:60). DR EMBL: M14768; MMALBPAA (128:140). DR EPD: EP16041; MM_ALBU. XX RN [1] RX MEDLINE; 89222448. RA Maire P., Wuarin J., Schibler U. RT The Role of Cis-Acting Promoter Elements in Tissue-Specific Albumin Gene RT Expression RL Science 244:343-346 (1989). RN [2] RX MEDLINE; 88080483. RA Lichtsteiner S., Wuarin J., Schibler U. RT The Interplay of DNA-Binding Proteins on the Promoter of the Mouse Albumin RT Gene RL Cell 51:963-973 (1987). XX // AC R00094 XX ID RAT$ALBU_18 XX DT 20.06.1990 (created); ewi. DT 14.12.1994 (updated); thh; ewi; mgo. CO Copyright (C), Biobase GmbH. XX TY D XX DE ALB (albumin); Gene: G000686. XX SQ GCAAGGGATTTAGTTA. XX SF -156 ST -141 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM DNase I footprinting XX CC conflict: RNALBPR starts at gggatt. XX DR EMBL: M16825; RNALBPR (1:16). DR EPD: EP16040; RN_ALBU. XX RN [1] RX MEDLINE; 87273526. RA Cereghini S., Raymondjean M., Garcia Carranca A., Herbomel P., Yaniv M. RT Factors Involved in Control of Tissue-Specific Expression of Albumin Gene RL Cell 50:627-638 (1987). XX // AC R00095 XX ID RAT$ALBU_19 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ALB (albumin); Gene: G000686. XX SQ TTTTTGGCAAGGAT. XX EL DE II XX SF -126 ST -107 XX BF T00535; NF-1; Quality: 6; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM DNase I footprinting XX DR TRANSPATH: XN000007723 DR EMBL: M16825; RNALBPR (30:43). DR EPD: EP16040; RN_ALBU. XX RN [1] RX MEDLINE; 87273526. RA Cereghini S., Raymondjean M., Garcia Carranca A., Herbomel P., Yaniv M. RT Factors Involved in Control of Tissue-Specific Expression of Albumin Gene RL Cell 50:627-638 (1987). XX // AC R00096 XX ID RAT$ALBU_20 XX DT 20.06.1990 (created); ewi. DT 02.05.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ALB (albumin); Gene: G000686. XX SQ TGGTATGAttttgtaatgGGGTAGGA. XX EL DE I XX SF -106 ST -88 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM DNase I footprinting MM gel retardation XX DR EMBL: M16825; RNALBPR (43:68). DR EPD: EP16040; RN_ALBU. XX RN [1] RX MEDLINE; 88234517. RA Costa R. H., Grayson D. R., Xanthopoulos K. G., Darnell jr J. E. RT A liver-specific DNA-binding protein recognizes multiple nucleotide sites RT in regulatory regions of transthyretin, alpha1-antitrypsin, albumin, and RT simian virus 40 genes RL Proc. Natl. Acad. Sci. USA 85:3840-3844 (1988). XX // AC R00097 XX ID RAT$ALBU_21 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ALB (albumin); Gene: G000686. XX SQ ATTTTGTAAT. XX EL DEI XX SF -105 ST -89 XX BF T00459; C/EBPbeta; Quality: 6; Species: rat, Rattus norvegicus. BF T01114; C/EBPdelta; Quality: 6; Species: mouse, Mus musculus. BF T00171; C/EBPepsilon; Quality: 6; Species: rat, Rattus norvegicus. XX MX M00621; V$CEBPDELTA_Q6 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl SO 0301; rec(rat-E.coli) SO 0303; rec(mouse-E.coli) XX MM DNase I footprinting MM direct gel shift XX CC also binding: all heterodimers XX DR TRANSPATH: XN000005720 DR TRANSPATH: XN000007256 DR EMBL: M16825; RNALBPR (50:59). DR EPD: EP16040; RN_ALBU. XX RN [1] RX MEDLINE; 91357471. RA Williams S. C., Cantwell C. A., Johnson P. F. RT A family of C/EBP-related proteins capable of forming covalently linked RT leucine zipper dimers in vitro RL Genes Dev. 5:1553-1567 (1991). RN [2] RX MEDLINE; 87273526. RA Cereghini S., Raymondjean M., Garcia Carranca A., Herbomel P., Yaniv M. RT Factors Involved in Control of Tissue-Specific Expression of Albumin Gene RL Cell 50:627-638 (1987). XX // AC R00098 XX ID RAT$ALBU_22 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ALB (albumin); Gene: G000686. XX SQ AACCAAT. XX SF -89 ST -64 XX BF T01014; ACF; Quality: 6; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl SO 0367; spleen XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000008430 DR EMBL: M16825; RNALBPR (68:74). DR EPD: EP16040; RN_ALBU. XX RN [1] RX MEDLINE; 88124920. RA Raymondjean M., Cereghini S., Yaniv M. RT Several distinct CCAAT box binding proteins coexist in eukaryotic cells RL Proc. Natl. Acad. Sci. USA 85:757-761 (1988). XX // AC R00099 XX ID RAT$ALBU_23 XX DT 20.06.1990 (created); ewi. DT 13.01.1998 (updated); tme. CO Copyright (C), Biobase GmbH. XX TY D XX DE ALB (albumin); Gene: G000686. XX SQ TGGTTAATGATCTACAGTTATTGGTTA. XX EL PE XX SF -72 ST -35 XX BF T00369; HNF-1; Quality: 4; Species: rat, Rattus norvegicus. BF T00889; HNF-1B; Quality: 6; Species: rat, Rattus norvegicus. BF T00371; HNF-3alpha; Quality: 4; Species: rat, Rattus norvegicus. XX MX M00724; V$HNF3ALPHA_Q6 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM DNase I footprinting MM gel retardation MM supershift (antibody binding) MM gel shift competition XX CC Site binds preferentially HNF-1 [1]. XX DR EMBL: M16825; RNALBPR (92:118). DR EPD: EP16040; RN_ALBU. XX RN [1] RX MEDLINE; 94218249. RA Gregori C., Kahn A., Pichard A. L. RT Activity of the rat liver-specific aldolase B promoter is restrained by HNF3 RL Nucleic Acids Res. 22:1242-1246 (1994). RN [2] RX MEDLINE; 91090848. RA Hattori M., tugores A., Veloz L., Karin M., Brenner D. A. RT A simplified method for the preparation of transcriptionally active liver RT nuclear extracts RL DNA Cell Biol. 9:777-781 (1991). RN [3] RX MEDLINE; 91224096. RA Rey-Campos J., Chouard T., Yaniv M., Cereghini S. RT vHNF1 is a homeoprotein that activates transcription and forms heterodimers RT with HNF1 RL EMBO J. 10:1445-1457 (1991). RN [4] RX MEDLINE; 87273526. RA Cereghini S., Raymondjean M., Garcia Carranca A., Herbomel P., Yaniv M. RT Factors Involved in Control of Tissue-Specific Expression of Albumin Gene RL Cell 50:627-638 (1987). XX // AC R00100 XX ID XEN$ALBU_24 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ALB 68 (68kd albumin); Gene: G000850. XX SQ GAATAATTTTC. XX EL HP1 site XX SF -68 ST -52 XX BF T00379; HP1 site factor; Quality: 6; Species: rat, Rattus norvegicus. XX MX M00725; V$HP1SITEFACTOR_Q6 XX OS clawed frog, Xenopus OC eukaryota; animalia; metazoa; chordata; vertebrata; amphibia; lissamphibia; OC anura; archeobatrachia; pipoidea; pipidae XX SO 0289; rl XX MM gel retardation XX DR TRANSPATH: XN000007531 DR EMBL: Y00381; XL68KALB (744:754). DR EPD: EP16039; XL_ALBU. XX RN [1] RX MEDLINE; 89160291. RA Ryffel G., Kugler W., Wagner U., Kaling M. RT Liver cell-specific gene transcription in vitro: the promoter elements HP1 RT and TATA box are necessary and sufficient to generate a liver-specific RT promoter RL Nucleic Acids Res. 17:939-953 (1989). RN [2] RX MEDLINE; 88233915. RA Kugler W., Wagner U., Ryffel G. U. RT Tissue-specificity of liver gene expression: a common liver-specific RT promoter element RL Nucleic Acids Res. 16:3165-3174 (1988). XX // AC R00101 XX ID AMULV$AMULV_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE A-MuLV; Gene: G000015. XX SQ CCAAT. XX SF -87 ST -59 XX OS A-MuLV, amphotropic murine leukemia virus OC viridae; ss-RNA enveloped viruses; positive strand RNA viruses; OC retroviridae; oncovirinae; type C oncovirus group; mammalian type C OC oncoviruses; murine leukemia viruses XX SO 0069; F9 SO 0171; PCC 4 XX MM DNase I footprinting MM gel retardation XX RN [1] RX MEDLINE; 88065491. RA Flamant F., Gurin C. C., Sorge J. A. RT An Embryonic DNA-Binding Protein Specific for the Promoter of the RT Retrovirus Long Terminal Repeat RL Mol. Cell. Biol. 7:3548-3553 (1987). XX // AC R00102 XX ID AMV$AMV_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AMV (avian myeloblastosis virus); Gene: G000016. XX SQ ATTACcaAA. XX EL LTR XX SF -262 ST -241 XX BF T00108; C/EBPalpha; Quality: 5; Species: rat, Rattus norvegicus. XX OS AMV, avian myeloblastosis virus OC viridae; ss-RNA enveloped viruses; positive strand RNA viruses; OC retroviridae; oncovirinae; type C oncovirus group; avian type C oncoviruses XX SO 0289; rl XX MM DNase I footprinting XX CC EMBL sequences are of 3'LTR XX DR TRANSPATH: XN000005721 DR EMBL: M24159; ALMAMV (1502:1510). DR EMBL: K00388; RELTR2 (71:79). XX RN [1] RX MEDLINE; 89261719. RA Ryden T. A., Beemon K. RT Avian Retroviral Long Terminal Repeats Bind CCAAT/Enhancer-Binding Protein RL Mol. Cell. Biol. 9:1155-1164 (1989). XX // AC R00103 XX ID AMV$AMV_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AMV (avian myeloblastosis virus); Gene: G000016. XX SQ CTTGCgtCA. XX EL LTR XX SF -154 ST -134 XX BF T00108; C/EBPalpha; Quality: 5; Species: rat, Rattus norvegicus. XX OS AMV, avian myeloblastosis virus OC viridae; ss-RNA enveloped viruses; positive strand RNA viruses; OC retroviridae; oncovirinae; type C oncovirus group; avian type C oncoviruses XX SO 0289; rl XX MM DNase I footprinting XX DR TRANSPATH: XN000005721 DR EMBL: M24159; ALMAMV (1610:1618). DR EMBL: K00388; RELTR2 (179:187). XX RN [1] RX MEDLINE; 89261719. RA Ryden T. A., Beemon K. RT Avian Retroviral Long Terminal Repeats Bind CCAAT/Enhancer-Binding Protein RL Mol. Cell. Biol. 9:1155-1164 (1989). XX // AC R00104 XX ID AMV$AMV_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AMV (avian myeloblastosis virus); Gene: G000016. XX SQ TTgtGTAAc. XX EL LTR XX SF -57 ST -37 XX BF T00108; C/EBPalpha; Quality: 5; Species: rat, Rattus norvegicus. XX OS AMV, avian myeloblastosis virus OC viridae; ss-RNA enveloped viruses; positive strand RNA viruses; OC retroviridae; oncovirinae; type C oncovirus group; avian type C oncoviruses XX SO 0289; rl XX MM DNase I footprinting XX DR TRANSPATH: XN000005721 DR EMBL: M24159; ALMAMV (1710:1718). DR EMBL: K00388; RELTR2 (279:287). XX RN [1] RX MEDLINE; 89261719. RA Ryden T. A., Beemon K. RT Avian Retroviral Long Terminal Repeats Bind CCAAT/Enhancer-Binding Protein RL Mol. Cell. Biol. 9:1155-1164 (1989). XX // AC R00105 XX ID MOUSE$AAMY_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAMY (alpha-amylase); Gene: G000466. XX SF -209 ST -158 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0027; AR4IP XX MM DNase I footprinting XX RN [1] RX MEDLINE; 89343964. RA Cockell M., Stevenson B. J., Strubin M., Hagenbuechle O., Wellauer P. K. RT Identification of a Cell-Specific DNA-Binding Activity That Interacts with RT a Transcriptional Activator of Genes Expressed in the Acinar Pancreas RL Mol. Cell. Biol. 9:2464-2476 (1989). XX // AC R00106 XX ID MOUSE$AAMY_02 XX DT 20.06.1990 (created); ewi. DT 31.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAMY (alpha-amylase); Gene: G000466. XX SQ CTCCATGGGAGTTTCTGAAGAACCTTCAGCTGTGCAC. XX SF -157 ST -120 XX BF T01227; PTF1; Quality: 6; Species: mouse, Mus musculus. BF T01421; PTF1-alpha; Quality: 6; Species: rat, Rattus norvegicus. BF T00701; PTF1-beta; Quality: 6; Species: rat, Rattus norvegicus. XX MX M00657; V$PTF1BETA_Q6 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0028; AR42J SO 0377; pancreas XX MM DNase I footprinting MM gel retardation MM direct gel shift MM methylation protection MM methylation interference XX DR TRANSPATH: XN000007938 DR TRANSPATH: XN000008669 DR TRANSPATH: XN000008843 DR EMBL: X02343; MMAMY2 (276:312). XX RN [1] RX MEDLINE; 92069764. RA Sommer L., Hagenbuechle O., Wellauer P. K., Strubin M. RT Nuclear targeting of the transcription factor PTF1 is mediated by a protein RT subunit that does not bind to the PTF1 cognate sequence RL Cell 67:987-994 (1991). RN [2] RX MEDLINE; 90097834. RA Petrucco S., Wellauer P. K., Hagenbuechle O. RT The DNA-Binding Activity of Transcription Factor PTF1 Parallels the RT Synthesis of Pancreas-Specific mRNAs during Mouse Development RL Mol. Cell. Biol. 10:254-264 (1990). RN [3] RX MEDLINE; 89343964. RA Cockell M., Stevenson B. J., Strubin M., Hagenbuechle O., Wellauer P. K. RT Identification of a Cell-Specific DNA-Binding Activity That Interacts with RT a Transcriptional Activator of Genes Expressed in the Acinar Pancreas RL Mol. Cell. Biol. 9:2464-2476 (1989). XX // AC R00107 XX ID MOUSE$AAMY_03 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAMY (alpha-amylase); Gene: G000466. XX SF -127 ST -87 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0027; AR4IP XX MM DNase I footprinting XX RN [1] RX MEDLINE; 89343964. RA Cockell M., Stevenson B. J., Strubin M., Hagenbuechle O., Wellauer P. K. RT Identification of a Cell-Specific DNA-Binding Activity That Interacts with RT a Transcriptional Activator of Genes Expressed in the Acinar Pancreas RL Mol. Cell. Biol. 9:2464-2476 (1989). XX // AC R00108 XX ID MOUSE$AAMY_04 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAMY (alpha-amylase); Gene: G000466. XX SF -88 ST -60 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0027; AR4IP SO 0028; AR42J XX MM DNase I footprinting XX RN [1] RX MEDLINE; 89343964. RA Cockell M., Stevenson B. J., Strubin M., Hagenbuechle O., Wellauer P. K. RT Identification of a Cell-Specific DNA-Binding Activity That Interacts with RT a Transcriptional Activator of Genes Expressed in the Acinar Pancreas RL Mol. Cell. Biol. 9:2464-2476 (1989). XX // AC R00109 XX ID MOUSE$AAMY_05 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAMY (alpha-amylase); Gene: G000466. XX SF -51 ST -20 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0028; AR42J XX MM DNase I footprinting XX RN [1] RX MEDLINE; 89343964. RA Cockell M., Stevenson B. J., Strubin M., Hagenbuechle O., Wellauer P. K. RT Identification of a Cell-Specific DNA-Binding Activity That Interacts with RT a Transcriptional Activator of Genes Expressed in the Acinar Pancreas RL Mol. Cell. Biol. 9:2464-2476 (1989). XX // AC R00110 XX ID MOUSE$AAMY_06 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAMY (alpha-amylase); Gene: G000466. XX SF -35 ST -20 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0027; AR4IP XX MM DNase I footprinting XX RN [1] RX MEDLINE; 89343964. RA Cockell M., Stevenson B. J., Strubin M., Hagenbuechle O., Wellauer P. K. RT Identification of a Cell-Specific DNA-Binding Activity That Interacts with RT a Transcriptional Activator of Genes Expressed in the Acinar Pancreas RL Mol. Cell. Biol. 9:2464-2476 (1989). XX // AC R00111 XX ID RAT$ANTEN_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ANTG (angiotensinogen); Gene: G000703. XX SQ ccacagttgggatttCCCAACctgaccag. XX EL APRE XX SF -557 ST -531 XX BF T00108; C/EBPalpha; Quality: 2; Species: rat, Rattus norvegicus. BF T00581; C/EBPbeta; Quality: 2; Species: human, Homo sapiens. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl SO 0301; rec(rat-E.coli) SO 0306; rec(human-E.coli) XX MM DNase I footprinting MM direct gel shift MM gel shift competition MM methylation interference XX DR TRANSPATH: XN000005722 DR TRANSPATH: XN000005723 DR EMBL: M31673; RNANG01 (127:155). XX RN [1] RX MEDLINE; 94193722. RA Brasier A. R., Kumar A. RT Identification of a novel determinant for basic domain-leucine zipper DNA RT binding activity in the acute-phase inducible nuclear factor-interleukin-6 RT transcription factor RL J. Biol. Chem. 269:10341-10351 (1994). RN [2] RX MEDLINE; 91203912. RA Ron D., Brasier A. R., Habener J. F. RT Angiotensinogen gene-inducible enhancer-binding protein 1, a member of a RT new family of large nuclear proteins that recognize nuclear factor RT kappaB-binding sites through a zinc finger motif RL Mol. Cell. Biol. 11:2887-2895 (1991). RN [3] RX MEDLINE; 91065323. RA Brasier A. R., Ron D., Tate J. E., Habener J. F. RT A family of constitutive C/EBP-like DNA binding proteins attenuate the RT IL-1alpha induced, NF-kappaB mediated trans-activation of the angiotensin RT gene acute-phase response element RL EMBO J. 9:3933-3944 (1990). RN [4] RX MEDLINE; 90158564. RA Ron D., Brasier A. R., Wright K. A., Tate J. E., Habener J. F. RT An inducible 50-kilodalton NFkappaB-like protein and a constitutive protein RT both bind the acute-phase response element of the angiotensinogen gene RL Mol. Cell. Biol. 10:1023-1032 (1990). XX // AC R00112 XX ID RAT$ANTEN_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ANTG (angiotensinogen); Gene: G000703. XX SQ CCACAGTTGGGATTTCCCAACCTGACCAG. XX EL APRE XX SF -557 ST -531 XX BF T00587; NF-kappaB; Quality: 5; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM DNase I footprinting MM gel retardation MM methylation interference XX CC NF-kappaB-like binding protein inducible XX DR TRANSPATH: XN000005724 DR EMBL: M31673; RNANG01 (127:155). XX RN [1] RX MEDLINE; 91203912. RA Ron D., Brasier A. R., Habener J. F. RT Angiotensinogen gene-inducible enhancer-binding protein 1, a member of a RT new family of large nuclear proteins that recognize nuclear factor RT kappaB-binding sites through a zinc finger motif RL Mol. Cell. Biol. 11:2887-2895 (1991). RN [2] RX MEDLINE; 91065323. RA Brasier A. R., Ron D., Tate J. E., Habener J. F. RT A family of constitutive C/EBP-like DNA binding proteins attenuate the RT IL-1alpha induced, NF-kappaB mediated trans-activation of the angiotensin RT gene acute-phase response element RL EMBO J. 9:3933-3944 (1990). RN [3] RX MEDLINE; 90158564. RA Ron D., Brasier A. R., Wright K. A., Tate J. E., Habener J. F. RT An inducible 50-kilodalton NFkappaB-like protein and a constitutive protein RT both bind the acute-phase response element of the angiotensinogen gene RL Mol. Cell. Biol. 10:1023-1032 (1990). XX // AC R00113 XX ID HS$ANTHIII_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AT3 (antithrombin III); Gene: G000202. XX SQ CCTTTGACCT. XX SF -89 ST -68 XX BF T00825; Tf-LF1; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0560; human liver XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000008152 DR EMBL: X00237; HSATH1 (377:386). XX RN [1] RX MEDLINE; 89098374. RA Ochoa A., Brunel F., Mendelzon D., Cohen G. N., Zakin M. M. RT Different liver nuclear proteins bind to similar sequences in the 5' RT flanking regions of three hepatic genes RL Nucleic Acids Res. 17:119-133 (1989). XX // AC R00114 XX ID HS$A1ANTR_01 XX DT 20.06.1990 (created); ewi. DT 12.02.1993 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000199. XX SQ CTCAGATCCCAGCCAGTGGACTTAGCCCCTGTTTGC. XX SF -134 ST -98 XX BF T00372; HNF-4alpha1; Quality: 1; Species: rat, Rattus norvegicus. BF T02429; HNF-4alpha1; Quality: 1; Species: clawed frog, Xenopus laevis. BF T02422; HNF-4alpha2; Quality: 1; Species: rat, Rattus norvegicus. BF T00468; LF-A1; Quality: 2; Species: rat, Rattus norvegicus. XX MX M00638; V$HNF4ALPHA_Q6 MX M00646; V$LFA1_Q6 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl SO 0320; rec(rat-ret lys) XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007520 DR TRANSPATH: XN000007619 DR TRANSPATH: XN000009275 DR TRANSPATH: XN000009293 DR EMBL: K02212; HSA1ATP (1822:1857). DR EPD: EP17092; HS_A1AT_3. XX RN [1] RX MEDLINE; 91122637. RA Sladek F. M., Zhong W., Lai E., Darnell jr J. E. RT Liver-enriched transcription factor HNF-4 is a novel member of the steroid RT hormone receptor superfamily RL Genes Dev. 4:2353-2365 (1990). RN [2] RX MEDLINE; 88328996. RA Monaci P., Nicosia A., Cortese R. RT Two different liver-specific factors stimulate in vitro transcription from RT the human alpha1-antitrypsin promoter RL EMBO J. 7:2075-2087 (1988). XX // AC R00115 XX ID HS$A1ANTR_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000199. XX SQ CAGCCAGTGGACTTAGCCCCTGTTTG. XX SF -128 ST -103 XX BF T00468; LF-A1; Quality: 6; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007619 DR EMBL: K02212; HSA1ATP (1831:1856). DR EPD: EP17092; HS_A1AT_3. XX RN [1] RX MEDLINE; 89098374. RA Ochoa A., Brunel F., Mendelzon D., Cohen G. N., Zakin M. M. RT Different liver nuclear proteins bind to similar sequences in the 5' RT flanking regions of three hepatic genes RL Nucleic Acids Res. 17:119-133 (1989). RN [2] RX MEDLINE; 89005060. RA Hardon E. M., Frain M., Paonessa G., Cortese R. RT Two distinct factors interact with the promoter regions of several RT liver-specific genes RL EMBO J. 7:1711-1719 (1988). XX // AC R00116 XX ID HS$A1ANTR_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000199. XX SQ ATCCCAGCCAGTGGACTTAGCCCCTGTTTG. XX SF -125 ST -96 XX BF T00468; LF-A1; Quality: 6; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007619 DR EMBL: K02212; HSA1ATP (1827:1856). DR EPD: EP17092; HS_A1AT_3. XX RN [1] RX MEDLINE; 90256819. RA Rangan V. S., Das G. C. RT Purification and Biochemical Characterization of Hepatocyte Nuclear Factor RT 2 Involved in Liver-specific Transcription of the Human alpha1-Antitrypsin RT Gene RL J. Biol. Chem. 265:8874-8879 (1990). RN [2] RX MEDLINE; 89039864. RA Li Y., Shen R.-F., Tsai S. Y., Woo S. L. C. RT Multiple Hepatic trans-Acting Factors Are Required for In Vitro RT Transcription of the Human Alpha-1-Antitrypsin Gene RL Mol. Cell. Biol. 8:4362-4369 (1988). XX // AC R00117 XX ID HS$A1ANTR_04 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000199. XX SQ CTCCGATAACTG. XX SF -97 ST -86 XX BF T00469; LF-A2; Quality: 6; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007620 DR EMBL: K02212; HSA1ATP (1860:1871). DR EPD: EP17092; HS_A1AT_3. XX RN [1] RX MEDLINE; 88328996. RA Monaci P., Nicosia A., Cortese R. RT Two different liver-specific factors stimulate in vitro transcription from RT the human alpha1-antitrypsin promoter RL EMBO J. 7:2075-2087 (1988). XX // AC R00118 XX ID HS$A1ANTR_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000199. XX SQ TGGTTAATATTCACCAgc. XX SF -86 ST -56 XX BF T00369; HNF-1; Quality: 3; Species: rat, Rattus norvegicus. BF T00889; HNF-1B; Quality: 6; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0092; H4II (H4IIE; H4IIE-3C) SO 0094; H5 SO 0289; rl XX MM DNase I footprinting MM direct gel shift MM supershift (antibody binding) MM gel shift competition MM methylation interference XX DR EMBL: K02212; HSA1ATP (1881:1898). DR EPD: EP17092; HS_A1AT_3. XX RN [1] RX MEDLINE; 91224095. RA de Simone V., de Magistris L., Lazzaro D., Gerstner J., Monaci P., Nicosia RA A., Cortese R. RT LFB3, a heterodimer-forming homeoprotein of the LFB1 family, is expressed RT in specialized epithelia RL EMBO J. 10:1435-1443 (1991). RN [2] RX MEDLINE; 89005060. RA Hardon E. M., Frain M., Paonessa G., Cortese R. RT Two distinct factors interact with the promoter regions of several RT liver-specific genes RL EMBO J. 7:1711-1719 (1988). XX // AC R00119 XX ID HS$A1ANTR_06 XX DT 20.06.1990 (created); ewi. DT 01.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000199. XX SQ GGGTGACCTTGGTTAATATT. XX SF -85 ST -66 XX BF T01015; AT-BP1; Quality: 6; Species: rat, Rattus norvegicus. BF T01016; AT-BP2; Quality: 6; Species: rat, Rattus norvegicus. BF T00470; LF-B2; Quality: 6; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl SO 0351; rec(rat-lambda) XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007621 DR TRANSPATH: XN000008431 DR TRANSPATH: XN000008436 DR EMBL: K02212; HSA1ATP (1872:1891). DR EPD: EP17092; HS_A1AT_3. XX RN [1] RX MEDLINE; 91187610. RA Mitchelmore C., Traboni C., Cortese R. RT Isolation of two cDNAs encoding zinc finger proteins which bind to the RT alpha1-antitrypsin promoter and to the major histocompatibility complex RT class I enhancer RL Nucleic Acids Res. 19:141-147 (1991). RN [2] RX MEDLINE; 88328996. RA Monaci P., Nicosia A., Cortese R. RT Two different liver-specific factors stimulate in vitro transcription from RT the human alpha1-antitrypsin promoter RL EMBO J. 7:2075-2087 (1988). XX // AC R00120 XX ID HS$A1ANTR_07 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000199. XX SQ ACCTTGGTTAATATTCACCAGCAG. XX SF -80 ST -57 XX BF T00369; HNF-1; Quality: 4; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM competitive DNAse I footprint MM gel retardation MM gel shift competition XX DR EMBL: K02212; HSA1ATP (1877:1900). DR EPD: EP17092; HS_A1AT_3. XX RN [1] RX MEDLINE; 88328996. RA Monaci P., Nicosia A., Cortese R. RT Two different liver-specific factors stimulate in vitro transcription from RT the human alpha1-antitrypsin promoter RL EMBO J. 7:2075-2087 (1988). XX // AC R00121 XX ID HS$A1ANTR_08 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000199. XX SQ GGGTGACCTTGGTTAATATTCACCAGCAG. XX SF -80 ST -52 XX BF T00369; HNF-1; Quality: 4; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation MM gel shift competition XX DR EMBL: K02212; HSA1ATP (1872:1900). DR EPD: EP17092; HS_A1AT_3. XX RN [1] RX MEDLINE; 90256819. RA Rangan V. S., Das G. C. RT Purification and Biochemical Characterization of Hepatocyte Nuclear Factor RT 2 Involved in Liver-specific Transcription of the Human alpha1-Antitrypsin RT Gene RL J. Biol. Chem. 265:8874-8879 (1990). RN [2] RX MEDLINE; 89039864. RA Li Y., Shen R.-F., Tsai S. Y., Woo S. L. C. RT Multiple Hepatic trans-Acting Factors Are Required for In Vitro RT Transcription of the Human Alpha-1-Antitrypsin Gene RL Mol. Cell. Biol. 8:4362-4369 (1988). XX // AC R00122 XX ID HS$A1ANTR_09 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000199. XX SQ TGGTTAATATTCACCA. XX SF -78 ST -52 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0173; PLC/PRF/5 XX MM DNase I footprinting MM gel retardation XX DR EMBL: K02212; HSA1ATP (1881:1896). DR EPD: EP17092; HS_A1AT_3. XX RN [1] RX MEDLINE; 88040463. RA Shen R.-F., Li Y., Sifers R. N., Wang H., Hardick C., Tsai S. Y., Woo S. L. RA C. RT Tissue-specific expression of the human alpha1-antitrypsin gene is RT controlled by multiple cis-regulatory elements RL Nucleic Acids Res. 15:8399-8415 (1987). XX // AC R00123 XX ID HS$A1ANTR_10 XX DT 20.06.1990 (created); ewi. DT 01.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000199. XX SQ GTTAATATTCACC. XX SF -78 ST -62 XX BF T00369; HNF-1; Quality: 4; Species: rat, Rattus norvegicus. BF T00379; HP1 site factor; Quality: 6; Species: rat, Rattus norvegicus. XX MX M00725; V$HP1SITEFACTOR_Q6 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0076; Faza SO 0289; rl XX MM DNase I footprinting MM gel retardation MM gel shift competition XX DR TRANSPATH: XN000007527 DR EMBL: K02212; HSA1ATP (1883:1895). DR EPD: EP17092; HS_A1AT_3. XX RN [1] RX MEDLINE; 88233915. RA Kugler W., Wagner U., Ryffel G. U. RT Tissue-specificity of liver gene expression: a common liver-specific RT promoter element RL Nucleic Acids Res. 16:3165-3174 (1988). RN [2] RX MEDLINE; 88042798. RA Courtois G., Morgan J. G., Campbell L. A., Fourel G., Crabtree G. R. RT Interaction of a liver-specific nuclear factor with the fibrinogen and RT alpha1-antitrypsin promoters RL Science 238:688-692 (1987). XX // AC R00124 XX ID HS$A1ANTR_11 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000199. XX SQ TGCCCCTCTGGATCCACTGCTTAA. XX SF -46 ST -23 XX BF T00472; LF-C; Quality: 6; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007622 DR EMBL: K02212; HSA1ATP (1911:1934). DR EPD: EP17092; HS_A1AT_3. XX RN [1] RX MEDLINE; 88328996. RA Monaci P., Nicosia A., Cortese R. RT Two different liver-specific factors stimulate in vitro transcription from RT the human alpha1-antitrypsin promoter RL EMBO J. 7:2075-2087 (1988). XX // AC R00125 XX ID MOUSE$A1ANTR_01 XX DT 20.06.1990 (created); ewi. DT 01.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000472. XX SQ CGTCAGGTGGGCACATAACCTACTC. XX EL site A XX SF -465 ST -441 XX BF T00105; C/EBPalpha; Quality: 2; Species: human, Homo sapiens. BF T00108; C/EBPalpha; Quality: 2; Species: rat, Rattus norvegicus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0104; HepG2 SO 0289; rl XX MM affinity chromatography MM DNase I footprinting MM gel retardation MM gel shift competition MM methylation protection MM methylation interference XX DR TRANSPATH: XN000005725 DR TRANSPATH: XN000005726 XX RN [1] RX MEDLINE; 89285897. RA Grayson D. R., Costa R. H., Darnell J. E. RT Regulation of hepatocyte-specific gene expression RL Ann. N. Y. Acad. Sci. 557:243-255 (1989). RN [2] RX MEDLINE; 88216579. RA Grayson D. R., Costa R. H., Xanthopoulos K. G., Darnell jr J. E. RT A Cell-Specific Enhancer of the Mouse alpha1-Antitrypsin Gene Has Multiple RT Functional Regions and Corresponding Protein-Binding Sites RL Mol. Cell. Biol. 8:1055-1066 (1988). RN [3] RX MEDLINE; 88234517. RA Costa R. H., Grayson D. R., Xanthopoulos K. G., Darnell jr J. E. RT A liver-specific DNA-binding protein recognizes multiple nucleotide sites RT in regulatory regions of transthyretin, alpha1-antitrypsin, albumin, and RT simian virus 40 genes RL Proc. Natl. Acad. Sci. USA 85:3840-3844 (1988). RN [4] RX MEDLINE; 88127142. RA Grayson D. R., Costa R. H., Xanthopoulos K. G., Darnell J. E. RT One Factor Recognizes the Liver-Specific Enhancers in alpha1-Antitrypsin RT and Transthyretin Genes RL Science 239:786-788 (1988). XX // AC R00126 XX ID MOUSE$A1ANTR_02 XX DT 20.06.1990 (created); ewi. DT 01.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000472. XX SQ CCATGTGACTCA. XX EL site B XX SF -292 ST -282 XX BF T00029; AP-1; Quality: 4; Species: human, Homo sapiens. BF T00031; AP-1; Quality: 4; Species: rat, Rattus norvegicus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa SO 0104; HepG2 SO 0289; rl SO 0366; brain SO 0367; spleen XX MM gel retardation MM gel shift competition MM methylation protection MM methylation interference XX DR TRANSPATH: XN000005727 DR TRANSPATH: XN000007038 XX RN [1] RX MEDLINE; 89285897. RA Grayson D. R., Costa R. H., Darnell J. E. RT Regulation of hepatocyte-specific gene expression RL Ann. N. Y. Acad. Sci. 557:243-255 (1989). RN [2] RX MEDLINE; 88216579. RA Grayson D. R., Costa R. H., Xanthopoulos K. G., Darnell jr J. E. RT A Cell-Specific Enhancer of the Mouse alpha1-Antitrypsin Gene Has Multiple RT Functional Regions and Corresponding Protein-Binding Sites RL Mol. Cell. Biol. 8:1055-1066 (1988). RN [3] RX MEDLINE; 88127142. RA Grayson D. R., Costa R. H., Xanthopoulos K. G., Darnell J. E. RT One Factor Recognizes the Liver-Specific Enhancers in alpha1-Antitrypsin RT and Transthyretin Genes RL Science 239:786-788 (1988). XX // AC R00127 XX ID MOUSE$A1ANTR_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AAT (alpha1-antitrypsin); Gene: G000472. XX SQ GCTTTGCTTAAGACTC. XX EL site C XX SF -210 ST -185 XX BF T00105; C/EBPalpha; Quality: 2; Species: human, Homo sapiens. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0104; HepG2 XX MM affinity chromatography MM DNase I footprinting MM gel retardation MM gel shift competition MM methylation protection MM methylation interference XX DR TRANSPATH: XN000005725 XX RN [1] RX MEDLINE; 89285897. RA Grayson D. R., Costa R. H., Darnell J. E. RT Regulation of hepatocyte-specific gene expression RL Ann. N. Y. Acad. Sci. 557:243-255 (1989). RN [2] RX MEDLINE; 88216579. RA Grayson D. R., Costa R. H., Xanthopoulos K. G., Darnell jr J. E. RT A Cell-Specific Enhancer of the Mouse alpha1-Antitrypsin Gene Has Multiple RT Functional Regions and Corresponding Protein-Binding Sites RL Mol. Cell. Biol. 8:1055-1066 (1988). RN [3] RX MEDLINE; 88234517. RA Costa R. H., Grayson D. R., Xanthopoulos K. G., Darnell jr J. E. RT A liver-specific DNA-binding protein recognizes multiple nucleotide sites RT in regulatory regions of transthyretin, alpha1-antitrypsin, albumin, and RT simian virus 40 genes RL Proc. Natl. Acad. Sci. USA 85:3840-3844 (1988). RN [4] RX MEDLINE; 88127142. RA Grayson D. R., Costa R. H., Xanthopoulos K. G., Darnell J. E. RT One Factor Recognizes the Liver-Specific Enhancers in alpha1-Antitrypsin RT and Transthyretin Genes RL Science 239:786-788 (1988). XX // AC R00129 XX ID DROME$ANTP_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Antp (Antennapedia); Gene: G000092. XX SQ ATAATATAATAATAAAAATAATAATAATAATAATATAAT. SQ ACTAATAGTATATATAATAATTTTAATAGTATGTTATATAAAT. XX S1 P1 start site SF -6 XX BF T00026; Antp; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0675; chemical XX MM DNase I footprinting XX DR TRANSPATH: XN000007028 DR Flybase: FBgn0000095; Antp. XX RN [1] RX MEDLINE; 89043970. RA Mihara H., Kaiser E. T. RT A chemically synthesized Antennapedia homeo domain binds to a specific DNA RT sequence RL Science 242:925-927 (1988). XX // AC R00130 XX ID DROME$ANTP_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Antp (Antennapedia); Gene: G000092. XX SQ GTCGCAGTCGCTGCC. XX EL P1-C XX SF -222 ST -200 XX BF T00008; Adf-1; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0131; Kc XX MM DNase I footprinting XX DR EMBL: M14497; DMANTPG1 (1806:1820). DR Flybase: FBgn0000095; Antp. XX RN [1] RX MEDLINE; 90202990. RA England B. P., Heberlein U., Tjian R. RT Purified Drosophila Transcription Factor, Adh Distal Factor-1 (Adf-1), RT Binds to Sites in Several Drosophila Promoters and Activates Transcription RL J. Biol. Chem. 265:5086-5094 (1990). XX // AC R00131 XX ID DROME$ANTP_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Antp (Antennapedia); Gene: G000092. XX SQ CGCTGTTGCGGCCGACGCTGACGCA. XX EL P1-B XX SF -192 ST -166 XX BF T00008; Adf-1; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0131; Kc XX MM DNase I footprinting XX DR EMBL: M14497; DMANTPG1 (1832:1856). DR Flybase: FBgn0000095; Antp. XX RN [1] RX MEDLINE; 90202990. RA England B. P., Heberlein U., Tjian R. RT Purified Drosophila Transcription Factor, Adh Distal Factor-1 (Adf-1), RT Binds to Sites in Several Drosophila Promoters and Activates Transcription RL J. Biol. Chem. 265:5086-5094 (1990). XX // AC R00132 XX ID DROME$ANTP_04 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Antp (Antennapedia); Gene: G000092. XX SQ CGCTGCCACCGCTG. SQ CGCCGCCGCCGCCG. XX EL P1-B XX SF -107 ST -67 XX BF T00008; Adf-1; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0131; Kc XX MM DNase I footprinting XX DR EMBL: M14497; DMANTPG1 (1916:1929). DR EMBL: M14497; DMANTPG1 (1936:1949). DR Flybase: FBgn0000095; Antp. XX RN [1] RX MEDLINE; 90202990. RA England B. P., Heberlein U., Tjian R. RT Purified Drosophila Transcription Factor, Adh Distal Factor-1 (Adf-1), RT Binds to Sites in Several Drosophila Promoters and Activates Transcription RL J. Biol. Chem. 265:5086-5094 (1990). XX // AC R00133 XX ID MOUSE$AP2_01 XX DT 20.06.1990 (created); ewi. DT 11.05.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AP2 (adipocyte protein P2); Gene: G000478. XX SQ aacaTGACTCAgaggaa. XX EL FSE2 XX SF -124 ST -101 XX BF T00029; AP-1; Quality: 2; Species: human, Homo sapiens. BF T00031; AP-1; Quality: 2; Species: rat, Rattus norvegicus. BF T00032; AP-1; Quality: 2; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0015; 208F SO 0096; H9+ SO 0100; HeLa SO 0170; PC12 SO 0468; adipocytes XX MM DNase I footprinting MM gel retardation MM avidin-biotin complex DNA binding assay XX CC factor binding induced by serum stimulation XX DR TRANSPATH: XN000005728 DR TRANSPATH: XN000007039 DR TRANSPATH: XN000007057 DR EMBL: M13261; MMP2AD1 (110:126). DR EPD: EP24033; MM_FABA. XX RN [1] RX MEDLINE; 90108682. RA Christy R. J., Yang V. W., Ntambi J. M., Geiman D. E., Landschulz W. H., RA Friedman A. D., Nakabeppu Y., Kelly T. J., Lane M. D. RT Differentiation-induced gene expression in 3T3-L1 preadipocytes: CCAAT/ RT enhancer binding protein interacts with and activates the promoters of two RT adipocyte-specific genes RL Genes Dev. 3:1323-1335 (1989). RN [2] RX MEDLINE; 89252808. RA Hay N., Takimoto M., Bishop J. M. RT A FOS protein is present in a complex that binds a negative regulator of MYC RL Genes Dev. 3:293-303 (1989). RN [3] RX MEDLINE; 88151051. RA Rauscher III F. J., Sambucetti L. C., Curran T., Distel R. J., Spiegelman RA B. M. RT Common DNA Binding Site for FOS Protein Complexes and Transcription Factor RT AP-1 RL Cell 52:471-480 (1988). RN [4] RX MEDLINE; 88145673. RA Franza jr B. R., Rauscher III F. J., Josephs S. F., Curran T. RT The Fos-complex and Fos-related antigens recognize sequence elements that RT contain AP-2 binding sites RL Science 239:1150-1153 (1988). RN [5] RX MEDLINE; 87215947. RA Distel R. J., Ro H.-S., Rosen B. S., Groves D. L., Spiegelman B. M. RT Nucleoprotein complexes that regulate gene expression in adipocyte RT differentiation: direct participation of c-fos RL Cell 49:835-844 (1987). XX // AC R00134 XX ID MOUSE$AP2_02 XX DT 20.06.1990 (created); ewi. DT 09.07.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AP2 (adipocyte protein P2); Gene: G000478. XX SQ GATCCATGACTCAGAGGAAAACATACG. XX EL FSE2 XX SF -124 ST -101 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0320; rec(rat-ret lys) XX MM gel retardation XX RN [1] RX MEDLINE; 89365144. RA Kouzarides T., Ziff E. RT Leucine zippers of fos, jun and GCN4 dictate dimerization specificity and RT thereby control DNA binding RL Nature 340:568-571 (1989). RN [2] RX MEDLINE; 89070696. RA Kouzarides T., Ziff E. RT The role of the leucine zipper in the fos-jun interaction RL Nature 336:646-651 (1988). XX // AC R00135 XX ID HS$APOA1_01 XX DT 20.06.1990 (created); ewi. DT 12.05.1997 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoAI (apolipoprotein AI); Gene: G000203. XX SQ CCCCCACTGAACCCTTGACCCCTGCCC. XX EL RARE, site A XX SF -221 ST -195 XX BF T00024; AID2; Quality: 6; Species: rat, Rattus norvegicus. BF T00045; ARP-1; Quality: 6; Species: human, Homo sapiens. BF T00149; COUP-TF1; Quality: 2; Species: human, Homo sapiens. BF T00467; LF-A1; Quality: 6; Species: human, Homo sapiens. BF T00553; NF-BA1; Quality: 6; Species: rat, Rattus norvegicus. BF T00719; RAR-alpha1; Quality: 6; Species: human, Homo sapiens. BF T00721; RAR-beta; Quality: 6; Species: human, Homo sapiens. BF T01345; RXR-alpha; Quality: 6; Species: human, Homo sapiens. XX MX M00646; V$LFA1_Q6 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa SO 0104; HepG2 SO 0289; rl SO 0323; rec(human-ret lys) SO 0344; rec(human-COS) SO 0367; spleen SO 0443; rec(human-CEF) XX MM DNase I footprinting MM functional analysis MM direct gel shift MM supershift (antibody binding) MM methylation interference XX CC Binding of RXR-alpha depends on 9-cis RA; element is responsive towards CC RAR-alpha, RAR-beta, and even more to RXR-alpha; overexpression of ARP-1 CC leads to repression of apoAI via this element XX DR TRANSPATH: XN000005729 DR TRANSPATH: XN000005730 DR TRANSPATH: XN000007022 DR TRANSPATH: XN000007081 DR TRANSPATH: XN000007236 DR TRANSPATH: XN000007616 DR TRANSPATH: XN000007757 DR TRANSPATH: XN000007999 DR EMBL: J04066; HSAPOA01 (1853:1879). DR EMBL: M20656; HSAPOA02 (2259:2285). DR EMBL: J00098; HSAPOAI1 (252:278). DR EPD: EP30021; HS_APA1. XX RN [1] RX MEDLINE; 96071177. RA Butler A. J., Parker M. G. RT COUP-TF II homodimers are formed in preference to heterodimers with RT RXRalpha or TRbeta in intact cells RL Nucleic Acids Res. 23:4143-4150 (1995). RN [2] RX MEDLINE; 92365821. RA Zhang X.-K., Lehmann J., Hoffmann B., Dawson M. I., Cameron J., Graupner RA G., Hermann T., Tran P., Pfahl M. RT Homodimer formation of retinoid X receptor induced by 9-cis retinoic acid RL Nature 358:587-591 (1992). RN [3] RX MEDLINE; 93024411. RA Tran P., Zhang X.-K., Salbert G., Hermann T., Lehmann J. M., Pfahl M. RT COUP orphan receptors are negative regulators of retinoic acid response RT pathways RL Mol. Cell. Biol. 12:4666-4676 (1992). RN [4] RX MEDLINE; 92334336. RA Widom R. L., Rhee M., Karathanasis S. K. RT Repression by ARP-1 sensitizes apolipoprotein AI gene responsiveness to RT RXRalpha and retinoic acid RL Mol. Cell. Biol. 12:3380-3389 (1992). RN [5] RX MEDLINE; 91170257. RA Papazafiri P., Ogami K., Ramji D. P., Nicosia A., Monaci P., Cladaras C., RA Zannis V. I. RT Promoter elements and factors involved in hepatic transcription of the RT human ApoA-I gene positive and negative regulators bind to overlapping sites RL J. Biol. Chem. 266:5790-5797 (1991). RN [6] RX MEDLINE; 91117233. RA Widom R. L., Ladias J. A. A., Kouidou S., Karathanasis S. K. RT Synergistic interactions between transcription factors control expression RT of the apolipoprotein AI gene in liver cells RL Mol. Cell. Biol. 11:677-687 (1991). RN [7] RX MEDLINE; 91260732. RA Rottman J. N., Widom R. L., Nadal-Ginard B., Mahdavi V., Karathanasis S. K. RT A retinoic acid-responsive element in the apolipoprotein A1 gene RT distinguishes between two different retinoic acid response pathways RL Mol. Cell. Biol. 11:3814-3820 (1991). RN [8] RX MEDLINE; 91118002. RA Ladias J. A. A., Karathanasis S. K. RT Regulation of the apolipoprotein A1 gene by ARP-1, a novel member of the RT steroid receptor superfamily RL Science 251:561-565 (1991). RN [9] RX MEDLINE; 91072376. RA Kardassis D., Zannis V. I., Claradas C. RT Purification and characterization of the nuclear factor BA1 RL J. Biol. Chem. 265:31733-21740 (1990). RN [10] RX MEDLINE; 89005060. RA Hardon E. M., Frain M., Paonessa G., Cortese R. RT Two distinct factors interact with the promoter regions of several RT liver-specific genes RL EMBO J. 7:1711-1719 (1988). XX // AC R00136 XX ID HS$APOA2_01 XX DT 20.06.1990 (created); ewi. DT 11.06.1993 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoAII (apolipoprotein AII); Gene: G000204. XX SQ CTCTCCCCCTCCCCCACCCC. XX EL distal region I, M XX SF -851 ST -832 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa SO 0289; rl XX MM DNase I footprinting MM direct gel shift XX CC binding factor is not AP-2 XX DR EMBL: X04898; HSAPOA2 (320:339). DR EMBL: X02905; HSAPOA2G (59:78). XX RN [1] RX MEDLINE; 91268033. RA Chambaz J., Cardot P., Pastier D., Zannis V. I., Cladaras C. RT Promoter elements and factors required for hepatic transcription of the RT human apoA-II gene RL J. Biol. Chem. 266:11676-11685 (1991). RN [2] RX MEDLINE; 89202040. RA Lucero M. A., Sanchez D., Ochoa A. R., Brunel F., Cohen G. N., Baralle F. RA E., Zakin M. M. RT Interaction of DNA-binding proteins with the tissue-specific human RT apolipoprotein-AII enhancer RL Nucleic Acids Res. 17:2283-2300 (1989). XX // AC R00137 XX ID HS$APOA2_02 XX DT 20.06.1990 (created); ewi. DT 11.06.1993 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoAII (apolipoprotein AII); Gene: G000204. XX SQ CCCCTGCTGACTCAATATTGGCTAATCAC. XX EL distal region I, N XX SF -799 ST -771 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation XX CC C/EBP-like factor + another component XX DR EMBL: X04898; HSAPOA2 (372:400). XX RN [1] RX MEDLINE; 91268033. RA Chambaz J., Cardot P., Pastier D., Zannis V. I., Cladaras C. RT Promoter elements and factors required for hepatic transcription of the RT human apoA-II gene RL J. Biol. Chem. 266:11676-11685 (1991). RN [2] RX MEDLINE; 89202040. RA Lucero M. A., Sanchez D., Ochoa A. R., Brunel F., Cohen G. N., Baralle F. RA E., Zakin M. M. RT Interaction of DNA-binding proteins with the tissue-specific human RT apolipoprotein-AII enhancer RL Nucleic Acids Res. 17:2283-2300 (1989). XX // AC R00138 XX ID HS$APOA2_03 XX DT 20.06.1990 (created); ewi. DT 31.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoAII (apolipoprotein AII); Gene: G000204. XX SQ CCCCTGCTGACTCAATATTGGCTAATCAC. XX SF -804 ST -769 XX BF T00105; C/EBPalpha; Quality: 4; Species: human, Homo sapiens. BF T00202; E; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000005731 DR TRANSPATH: XN000007297 DR EMBL: X04898; HSAPOA2 (372:400). XX RN [1] RX MEDLINE; 89202040. RA Lucero M. A., Sanchez D., Ochoa A. R., Brunel F., Cohen G. N., Baralle F. RA E., Zakin M. M. RT Interaction of DNA-binding proteins with the tissue-specific human RT apolipoprotein-AII enhancer RL Nucleic Acids Res. 17:2283-2300 (1989). XX // AC R00139 XX ID HS$APOA2_04 XX DT 20.06.1990 (created); ewi. DT 11.06.1993 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoAII (apolipoprotein AII); Gene: G000204. XX SQ GTGATCAAATG. XX EL distal region I, K XX SF -756 ST -740 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa SO 0289; rl XX MM DNase I footprinting MM gel retardation XX CC 3' border can extend to -718 XX DR EMBL: X04898; HSAPOA2 (418:428). DR EMBL: X02905; HSAPOA2G (156:166). XX RN [1] RX MEDLINE; 91268033. RA Chambaz J., Cardot P., Pastier D., Zannis V. I., Cladaras C. RT Promoter elements and factors required for hepatic transcription of the RT human apoA-II gene RL J. Biol. Chem. 266:11676-11685 (1991). RN [2] RX MEDLINE; 89202040. RA Lucero M. A., Sanchez D., Ochoa A. R., Brunel F., Cohen G. N., Baralle F. RA E., Zakin M. M. RT Interaction of DNA-binding proteins with the tissue-specific human RT apolipoprotein-AII enhancer RL Nucleic Acids Res. 17:2283-2300 (1989). XX // AC R00140 XX ID HS$APOA2_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoAII (apolipoprotein AII); Gene: G000204. XX SQ CTTCAACCTTTACCCTGGT. XX EL distal region I, J XX SF -735 ST -714 XX BF T00553; NF-BA1; Quality: 6; Species: rat, Rattus norvegicus. BF T00826; Tf-LF1; Quality: 6; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007758 DR TRANSPATH: XN000008154 DR EMBL: X04898; HSAPOA2 (438:456). DR EMBL: X02905; HSAPOA2G (176:194). XX RN [1] RX MEDLINE; 91268033. RA Chambaz J., Cardot P., Pastier D., Zannis V. I., Cladaras C. RT Promoter elements and factors required for hepatic transcription of the RT human apoA-II gene RL J. Biol. Chem. 266:11676-11685 (1991). RN [2] RX MEDLINE; 91072376. RA Kardassis D., Zannis V. I., Claradas C. RT Purification and characterization of the nuclear factor BA1 RL J. Biol. Chem. 265:31733-21740 (1990). RN [3] RX MEDLINE; 89202040. RA Lucero M. A., Sanchez D., Ochoa A. R., Brunel F., Cohen G. N., Baralle F. RA E., Zakin M. M. RT Interaction of DNA-binding proteins with the tissue-specific human RT apolipoprotein-AII enhancer RL Nucleic Acids Res. 17:2283-2300 (1989). XX // AC R00141 XX ID HS$APOA2_06 XX DT 20.06.1990 (created); ewi. DT 11.06.1993 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoAII (apolipoprotein AII); Gene: G000204. XX SQ TCACCtctTTTCCTGCCAGAGCCC. XX EL distal region I, I XX SF -703 ST -678 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa SO 0289; rl XX MM DNase I footprinting MM gel retardation XX DR EMBL: X04898; HSAPOA2 (470:493). DR EMBL: X02905; HSAPOA2G (208:231). XX RN [1] RX MEDLINE; 91268033. RA Chambaz J., Cardot P., Pastier D., Zannis V. I., Cladaras C. RT Promoter elements and factors required for hepatic transcription of the RT human apoA-II gene RL J. Biol. Chem. 266:11676-11685 (1991). RN [2] RX MEDLINE; 89202040. RA Lucero M. A., Sanchez D., Ochoa A. R., Brunel F., Cohen G. N., Baralle F. RA E., Zakin M. M. RT Interaction of DNA-binding proteins with the tissue-specific human RT apolipoprotein-AII enhancer RL Nucleic Acids Res. 17:2283-2300 (1989). XX // AC R00142 XX ID HS$APOE_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoE (apolipoprotein E); Gene: G000207. XX SQ CCTCTCCAGATTACATTCATC. XX SF -336 ST -315 XX BF T00764; SRF; Quality: 5; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0104; HepG2 XX MM DNase I footprinting XX DR TRANSPATH: XN000014284 DR EMBL: M10065; HSAPOE4 (711:731). DR EPD: EP36007; HS_APE. XX RN [1] RX MEDLINE; 88228059. RA Smith J. D., Melian A., Leff T., Breslow J. L. RT Expression of the Human Apolipoprotein E Gene is Regulated by Multiple RT Positive and Negative Elements RL J. Biol. Chem. 263:8300-8308 (1988). XX // AC R00143 XX ID HS$APOE_02 XX DT 20.06.1990 (created); ewi. DT 20.04.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoE (apolipoprotein E); Gene: G000207. XX SQ GCCCCCAGAATC. XX SF -241 ST -233 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0104; HepG2 XX MM DNase I footprinting XX CC conflict: last nucleotide of this element in HSAPOE4(805:816) is G XX DR EMBL: M10065; HSAPOE4 (805:816). DR EPD: EP36007; HS_APE. XX RN [1] RX MEDLINE; 88228059. RA Smith J. D., Melian A., Leff T., Breslow J. L. RT Expression of the Human Apolipoprotein E Gene is Regulated by Multiple RT Positive and Negative Elements RL J. Biol. Chem. 263:8300-8308 (1988). XX // AC R00144 XX ID HS$APOE_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoE (apolipoprotein E); Gene: G000207. XX SQ TGGTCAAAAGACCTCT. XX SF -187 ST -167 XX BF T00261; ER-alpha; Quality: 1; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0104; HepG2 XX MM DNase I footprinting XX DR TRANSPATH: XN000005732 DR EMBL: M10065; HSAPOE4 (875:890). DR EPD: EP36007; HS_APE. XX RN [1] RX MEDLINE; 88228059. RA Smith J. D., Melian A., Leff T., Breslow J. L. RT Expression of the Human Apolipoprotein E Gene is Regulated by Multiple RT Positive and Negative Elements RL J. Biol. Chem. 263:8300-8308 (1988). XX // AC R00145 XX ID HS$APOE_04 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoE (apolipoprotein E); Gene: G000207. XX SQ ACCTCTATGCCCCACCTCCTTC. XX SF -165 ST -144 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0104; HepG2 XX MM DNase I footprinting XX DR EMBL: M10065; HSAPOE4 (885:906). DR EPD: EP36007; HS_APE. XX RN [1] RX MEDLINE; 88330840. RA Paik Y.-K., Chang D. J., Reardon C. A., Walker M. D., Taxman E., Taylor J. RA M. RT Identification and Characterization of Transcriptional Regulatory Regions RT Associated with Expression of the Human Apolipoprotein E Gene RL J. Biol. Chem. 263:13340-13349 (1988). XX // AC R00146 XX ID HS$APOE_05 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoE (apolipoprotein E); Gene: G000207. XX SQ ACCTCTATGCCCCACCTCCTTC. XX SF -161 ST -141 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0491; CHO XX MM DNase I footprinting XX DR EMBL: M10065; HSAPOE4 (885:906). DR EPD: EP36007; HS_APE. XX RN [1] RX MEDLINE; 88330840. RA Paik Y.-K., Chang D. J., Reardon C. A., Walker M. D., Taxman E., Taylor J. RA M. RT Identification and Characterization of Transcriptional Regulatory Regions RT Associated with Expression of the Human Apolipoprotein E Gene RL J. Biol. Chem. 263:13340-13349 (1988). XX // AC R00147 XX ID HS$APOE_06 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoE (apolipoprotein E); Gene: G000207. XX SQ CCCCACCTC. XX SF -157 ST -146 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0104; HepG2 XX MM DNase I footprinting XX DR EMBL: M10065; HSAPOE4 (894:902). DR EPD: EP36007; HS_APE. XX RN [1] RX MEDLINE; 88228059. RA Smith J. D., Melian A., Leff T., Breslow J. L. RT Expression of the Human Apolipoprotein E Gene is Regulated by Multiple RT Positive and Negative Elements RL J. Biol. Chem. 263:8300-8308 (1988). XX // AC R00148 XX ID HS$APOE_07 XX DT 20.06.1990 (created); ewi. DT 20.04.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoE (apolipoprotein E); Gene: G000207. XX SQ GCCCACCTCGTGACTGGGGGC. XX SF -104 ST -86 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX MM DNase I footprinting XX CC conflict: HSAPOE4(946:) is gcccacctcgtgactgggCTG XX DR EMBL: M10065; HSAPOE4 (946:966). DR EPD: EP36007; HS_APE. XX RN [1] RX MEDLINE; 88228059. RA Smith J. D., Melian A., Leff T., Breslow J. L. RT Expression of the Human Apolipoprotein E Gene is Regulated by Multiple RT Positive and Negative Elements RL J. Biol. Chem. 263:8300-8308 (1988). XX // AC R00149 XX ID HS$APOE_08 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoE (apolipoprotein E); Gene: G000207. XX SQ GGGCGG. XX SF -61 ST -44 XX BF T00759; Sp1; Quality: 5; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX MM DNase I footprinting XX DR EMBL: M10065; HSAPOE4 (994:999). DR EPD: EP36007; HS_APE. XX RN [1] RX MEDLINE; 88228059. RA Smith J. D., Melian A., Leff T., Breslow J. L. RT Expression of the Human Apolipoprotein E Gene is Regulated by Multiple RT Positive and Negative Elements RL J. Biol. Chem. 263:8300-8308 (1988). XX // AC R00150 XX ID HS$APOE_09 XX DT 20.06.1990 (created); ewi. DT 13.07.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoE (apolipoprotein E); Gene: G000207. XX SQ GCCCGCCC. XX SF -59 ST -45 XX BF T00759; Sp1; Quality: 6; Species: human, Homo sapiens. BF T01228; Sp1; Quality: 5; Species: hamster. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0104; HepG2 SO 0491; CHO XX MM DNase I footprinting MM primer extension footprint XX DR TRANSPATH: XN000008672 DR EMBL: M10065; HSAPOE4 (971:978). DR EPD: EP36007; HS_APE. XX RN [1] RX MEDLINE; 88330840. RA Paik Y.-K., Chang D. J., Reardon C. A., Walker M. D., Taxman E., Taylor J. RA M. RT Identification and Characterization of Transcriptional Regulatory Regions RT Associated with Expression of the Human Apolipoprotein E Gene RL J. Biol. Chem. 263:13340-13349 (1988). XX // AC R00151 XX ID HS$APOE_10 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoE (apolipoprotein E); Gene: G000207. XX SQ GAGCTCAGGGGCC. XX SF 69 ST 87 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0104; HepG2 XX MM DNase I footprinting XX DR EMBL: M10065; HSAPOE4 (1120:1132). DR EPD: EP36007; HS_APE. XX RN [1] RX MEDLINE; 88228059. RA Smith J. D., Melian A., Leff T., Breslow J. L. RT Expression of the Human Apolipoprotein E Gene is Regulated by Multiple RT Positive and Negative Elements RL J. Biol. Chem. 263:8300-8308 (1988). XX // AC R00152 XX ID HS$APOE_11 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoE (apolipoprotein E); Gene: G000207. XX SQ CGGGGGTGAGGCAAGCAGC. XX SF 173 ST 191 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX MM DNase I footprinting XX DR EMBL: M10065; HSAPOE4 (1220:1238). XX RN [1] RX MEDLINE; 88228059. RA Smith J. D., Melian A., Leff T., Breslow J. L. RT Expression of the Human Apolipoprotein E Gene is Regulated by Multiple RT Positive and Negative Elements RL J. Biol. Chem. 263:8300-8308 (1988). XX // AC R00153 XX ID CHICK$APOVLDL_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoVLDL II (apo very low density lipoprotein); Gene: G000048. XX SQ GGGGCTCAGTGACCC. XX EL E2 XX SF -222 ST -198 XX BF T00264; ER-alpha; Quality: 4; Species: chick, Gallus gallus. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0374; cl+E SO 0617; oviduct SO 0766; LHL SO 0767; RLE SO 0768; RLN XX MM DNase I footprinting MM genomic in situ DNAse I footprinting MM in vivo / genomic methylation protection XX DR TRANSPATH: XN000007400 DR EMBL: J00810; GGAPOLP2 (1580:1594). DR EMBL: V00448; GGVL01 (264:278). DR EPD: EP07090; GG_APV1. XX RN [1] RX MEDLINE; 91187646. RA Wijnholds J., Muller E., Ab G. RT Oestrogen facilitates the binding of ubiquitous and liver-enriched nuclear RT proteins to the apoVLDL II promoter in vivo RL Nucleic Acids Res. 19:33-41 (1991). RN [2] RX MEDLINE; 92020230. RA Beekman J. M., Wijnholds J., Schippers I. J., Pot W., Gruber M., Ab G. RT Regulatory elements and DNA-binding proteins mediating transcription from RT the chicken very-low-density apolipoprotein II gene RL Nucleic Acids Res. 19:5371-5377 (1991). RN [3] RX MEDLINE; 89030640. RA Wijnholds J., Philipsen J. N. J., Ab G. RT Tissue-specific and steroid-dependent interaction of transcription factors RT with the oestrogen-inducible apoVLDL II promoter in vivo RL EMBO J. 7:2757-2763 (1988). XX // AC R00154 XX ID CHICK$APOVLDL_02 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoVLDL II (apo very low density lipoprotein); Gene: G000048. XX SQ AGGTCAGACTGACCT. XX EL E1 XX SF -186 ST -165 XX BF T00264; ER-alpha; Quality: 4; Species: chick, Gallus gallus. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0374; cl+E SO 0617; oviduct SO 0766; LHL SO 0767; RLE SO 0768; RLN XX MM DNase I footprinting MM genomic in situ DNAse I footprinting MM in vivo / genomic methylation protection XX DR TRANSPATH: XN000007400 DR EMBL: J00810; GGAPOLP2 (1624:1638). XX RN [1] RX MEDLINE; 91187646. RA Wijnholds J., Muller E., Ab G. RT Oestrogen facilitates the binding of ubiquitous and liver-enriched nuclear RT proteins to the apoVLDL II promoter in vivo RL Nucleic Acids Res. 19:33-41 (1991). RN [2] RX MEDLINE; 92020230. RA Beekman J. M., Wijnholds J., Schippers I. J., Pot W., Gruber M., Ab G. RT Regulatory elements and DNA-binding proteins mediating transcription from RT the chicken very-low-density apolipoprotein II gene RL Nucleic Acids Res. 19:5371-5377 (1991). RN [3] RX MEDLINE; 89030640. RA Wijnholds J., Philipsen J. N. J., Ab G. RT Tissue-specific and steroid-dependent interaction of transcription factors RT with the oestrogen-inducible apoVLDL II promoter in vivo RL EMBO J. 7:2757-2763 (1988). XX // AC R00155 XX ID CHICK$APOVLDL_03 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoVLDL II (apo very low density lipoprotein); Gene: G000048. XX SQ GGTCCAGAGTCC. XX EL C XX SF -140 ST -129 XX BF T00466; LF-A1; Quality: 4; Species: chick, Gallus gallus. XX MX M00646; V$LFA1_Q6 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0374; cl+E SO 0766; LHL SO 0767; RLE SO 0768; RLN XX MM gel retardation MM in vivo / genomic methylation protection XX DR TRANSPATH: XN000007615 DR EMBL: J00810; GGAPOLP2 (1662:1673). DR EMBL: V00448; GGVL01 (345:356). DR EPD: EP07090; GG_APV1. XX RN [1] RX MEDLINE; 91187646. RA Wijnholds J., Muller E., Ab G. RT Oestrogen facilitates the binding of ubiquitous and liver-enriched nuclear RT proteins to the apoVLDL II promoter in vivo RL Nucleic Acids Res. 19:33-41 (1991). RN [2] RX MEDLINE; 92020230. RA Beekman J. M., Wijnholds J., Schippers I. J., Pot W., Gruber M., Ab G. RT Regulatory elements and DNA-binding proteins mediating transcription from RT the chicken very-low-density apolipoprotein II gene RL Nucleic Acids Res. 19:5371-5377 (1991). RN [3] RX MEDLINE; 89030640. RA Wijnholds J., Philipsen J. N. J., Ab G. RT Tissue-specific and steroid-dependent interaction of transcription factors RT with the oestrogen-inducible apoVLDL II promoter in vivo RL EMBO J. 7:2757-2763 (1988). XX // AC R00156 XX ID CHICK$APOVLDL_04 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoVLDL II (apo very low density lipoprotein); Gene: G000048. XX SQ GGGGAAAC. XX SF -97 ST -62 XX BF T00107; C/EBPalpha; Quality: 4; Species: chick, Gallus gallus. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0374; cl+E XX MM DNase I footprinting MM genomic in situ DNAse I footprinting MM in vivo / genomic methylation protection XX DR TRANSPATH: XN000007174 DR EMBL: J00810; GGAPOLP2 (1727:1734). XX RN [1] RX MEDLINE; 91187646. RA Wijnholds J., Muller E., Ab G. RT Oestrogen facilitates the binding of ubiquitous and liver-enriched nuclear RT proteins to the apoVLDL II promoter in vivo RL Nucleic Acids Res. 19:33-41 (1991). RN [2] RX MEDLINE; 89030640. RA Wijnholds J., Philipsen J. N. J., Ab G. RT Tissue-specific and steroid-dependent interaction of transcription factors RT with the oestrogen-inducible apoVLDL II promoter in vivo RL EMBO J. 7:2757-2763 (1988). XX // AC R00157 XX ID CHICK$APOVLDL_05 XX DT 20.06.1990 (created); ewi. DT 04.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE apoVLDL II (apo very low density lipoprotein); Gene: G000048. XX SQ GGACCTTTGACCC. XX EL A XX SF -69 ST -40 XX BF T00148; COUP; Quality: 3; Species: chick, Gallus gallus. BF T00466; LF-A1; Quality: 4; Species: chick, Gallus gallus. XX MX M00646; V$LFA1_Q6 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0374; cl+E XX MM DNase I footprinting MM genomic in situ DNAse I footprinting MM gel retardation MM direct gel shift MM supershift (antibody binding) MM gel shift competition MM in vivo / genomic methylation protection XX DR TRANSPATH: XN000007226 DR TRANSPATH: XN000007615 DR EMBL: J00810; GGAPOLP2 (1741:1753). DR EMBL: V00448; GGVL01 (425:437). DR EPD: EP07090; GG_APV1. XX RN [1] RX MEDLINE; 91187646. RA Wijnholds J., Muller E., Ab G. RT Oestrogen facilitates the binding of ubiquitous and liver-enriched nuclear RT proteins to the apoVLDL II promoter in vivo RL Nucleic Acids Res. 19:33-41 (1991). RN [2] RX MEDLINE; 92020230. RA Beekman J. M., Wijnholds J., Schippers I. J., Pot W., Gruber M., Ab G. RT Regulatory elements and DNA-binding proteins mediating transcription from RT the chicken very-low-density apolipoprotein II gene RL Nucleic Acids Res. 19:5371-5377 (1991). RN [3] RX MEDLINE; 89030640. RA Wijnholds J., Philipsen J. N. J., Ab G. RT Tissue-specific and steroid-dependent interaction of transcription factors RT with the oestrogen-inducible apoVLDL II promoter in vivo RL EMBO J. 7:2757-2763 (1988). XX // AC R00158 XX ID HS$ANF_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE ANF (atrial natriuretic factor); Gene: G000200. XX SF -400 ST -208 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0149; MCC XX MM gel retardation XX RN [1] RX MEDLINE; 88243782. RA LaPointe M. C., Wu J., Greenberg B., Gardner D. G. RT Upstream Sequences Confer Atrial-specific Expression on the Human Atrial RT Factor Gene RL J. Biol. Chem. 263:9075-9078 (1988). XX // AC R00159 XX ID HS$ANF_02 XX DT 20.06.1990 (created); ewi. DT 11.05.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ANF (atrial natriuretic factor); Gene: G000200. XX SQ GGGCACCAGCAAGCGTCA. XX SF -369 ST -352 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0368; neonatal cardiocytes (rat) XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR EMBL: K02043; HSANF (100:117). XX RN [1] RX MEDLINE; 89197955. RA Wu J., LaPointe M. C., West B. L., Gardner D. G. RT Tissue-specific Determinants of Human Atrial Natriuretic Factor Gene RT Expression in Cardiac Tissue RL J. Biol. Chem. 264:6472-6479 (1989). XX // AC R00160 XX ID HS$OAS_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE OAS (2'-5' oligoadenylate synthetase); Gene: G000351. XX SQ CTCCTCCCTTCTGAGGAAACGAAACCAACAGCAGT. XX S1 ATG SF -113 ST -74 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0055; COS-1+ SO 0061; Daudi SO 0195; T98G SO 0380; Daudi + CML XX MM gel retardation XX DR EMBL: M18099; HSOASE5G (1294:1328). XX RN [1] RX MEDLINE; 91056171. RA Seong D. C., Sims S., Johnson E., Howard O. M. Z., Reiter B., Hester J., RA Talpaz M., Kantarjian H., Deisseroth A. RT A phosphatase activity present in peripheral blood myeloid cells of chromic RT myelogenous leukemia patients but not normal individuals alters nuclear RT protein binding to transcriptional enhancers of interferon-inducible genes RL J. Clin. Invest. 86:1664-1670 (1990). RN [2] RX MEDLINE; 88283644. RA Rutherford M. N., Hannigan G. E., Williams B. R. G. RT Interferon-induced binding of nuclear factors to promoter elements of the RT 2-5A synthetase gene RL EMBO J. 7:751-759 (1988). XX // AC R00161 XX ID HS$OAS_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE OAS (2'-5' oligoadenylate synthetase); Gene: G000351. XX SF -112 ST -73 XX BF T00711; R1; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0101; HeLa+ XX MM gel retardation XX DR TRANSPATH: XN000007951 XX RN [1] RX MEDLINE; 89160323. RA Cohen B., Vaiman D., Chebath J. RT Enhancer functions and in vitro protein binding of native and mutated RT interferon-responsive sequences RL Nucleic Acids Res. 17:1679-1695 (1989). XX // AC R00162 XX ID HS$OAS_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE OAS (2'-5' oligoadenylate synthetase); Gene: G000351. XX SF -112 ST -73 XX BF T00712; R2; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa SO 0378; lymphocytes SO 0379; monocytes XX MM gel retardation XX DR TRANSPATH: XN000007955 XX RN [1] RX MEDLINE; 91072330. RA Wedrychowski A., Seong D., Paslidis N., Johnson E., Howard O. M. Z., Sims RA S., Talpaz M., Kantarjian H., Hester J., Turpin J., Lopez-Berestein G., RA Gutterman J., Freireich E. J., Deisseroth A. RT Characterization of nuclear proteins which bind to interferon-inducible RT transcriptional enhancers in hematopoietic cells RL J. Biol. Chem. 65:21433-21440 (1990). RN [2] RX MEDLINE; 89160323. RA Cohen B., Vaiman D., Chebath J. RT Enhancer functions and in vitro protein binding of native and mutated RT interferon-responsive sequences RL Nucleic Acids Res. 17:1679-1695 (1989). XX // AC R00163 XX ID HS$OAS_04 XX DT 20.06.1990 (created); ewi. DT 04.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE OAS (2'-5' oligoadenylate synthetase); Gene: G000351. XX SQ TGAGGAAACGAAACCA. XX SF -107 ST -83 XX BF T00402; ICSBP; Quality: 6; Species: mouse, Mus musculus. XX MX M00699; V$ICSBP_Q6 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0101; HeLa+ SO 0303; rec(mouse-E.coli) XX MM direct gel shift MM Southwestern blotting / filter binding XX DR TRANSPATH: XN000005733 DR EMBL: M18099; HSOASE5G (1305:1320). XX RN [1] RX MEDLINE; 90251633. RA Driggers P. H., Ennist D. L., Gleason S. L., Mak W.-H., Marks M. S., Levi RA B.-Z., Flanagan J. R., Appella E., Ozato K. RT An interferon gamma-regulated protein that binds the interferon-inducible RT enhancer element of major histocompatibility complex class I genes RL Proc. Natl. Acad. Sci. USA 87:3743-3747 (1990). RN [2] RX MEDLINE; 90251633. RA Driggers P. H., Ennist D. L., Gleason S. L., Mak W.-H., Marks M. S., Levi RA B.-Z., Flanagan J. R., Appella E., Ozato K. RT An interferon gamma-regulated protein that binds the interferon-inducible RT enhancer element of major histocompatibility complex class I genes RL Proc. Natl. Acad. Sci. USA 87:3743-3747 (1990). RN [3] RX MEDLINE; 89160323. RA Cohen B., Vaiman D., Chebath J. RT Enhancer functions and in vitro protein binding of native and mutated RT interferon-responsive sequences RL Nucleic Acids Res. 17:1679-1695 (1989). XX // AC R00164 XX ID MOUSE$OAS_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE OAS (2'-5' oligoadenylate synthetase); Gene: G000580. XX SQ TGAGGAAACGAAACCA. XX EL element B XX SF -102 ST -87 XX BF T00421; IREBF-1; Quality: 6; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0061; Daudi SO 0100; HeLa SO 0204; WISH SO 0676; rec(mouse-lambda-E.coli) XX MM gel retardation XX RN [1] RX MEDLINE; 91095416. RA Yan C., Tamm I. RT Molecular cloning and characterization of interferon alpha/beta response RT element binding factors of the murine (2'-5')oligoadenylate synthetase RT ME-12 gene RL Proc. Natl. Acad. Sci. USA 88:144-148 (1991). RN [2] RX MEDLINE; 88312589. RA Cohen B., Peretz D., Vaiman D., Benech P., Chebath J. RT Enhancer-like interferon responsive sequences of the human and murine RT (2'-5') oligoadenylate synthetase gene promoters RL EMBO J. 7:1411-1419 (1988). XX // AC R00165 XX ID MOUSE$OAS_06 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE OAS (2'-5' oligoadenylate synthetase); Gene: G000580. XX SQ cttctcGGGAAATGGAAACTgaaaatc. XX EL ISRE; IRE, B region XX S1 ATG SF -80 ST -52 XX BF T00429; ISRF; Quality: 6; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0004; 3T3+ SO 0101; HeLa+ SO 0465; A31+ XX MM direct gel shift XX DR TRANSPATH: XN000007569 XX RN [1] RX MEDLINE; 91224969. RA Hannigan G. E., Williams B. R. G. RT Induced factor binding to the interferon-stimulated response element RL J. Biol. Chem. 266:8765-8770 (1991). RN [2] RX MEDLINE; 91102570. RA Hannigan G. E., Williams B. R. G. RT Signal transduction by interferon-alpha through arachidonic acid metabolism RL Science 251:204-207 (1991). RN [3] RX MEDLINE; 91056057. RA Yan C., Tamm I. RT Protein factors that bind to the murine 2',5'-oligoadenylate synthetase RT ME-12 gene 5' upstream regulatory region RL J. Biol. Chem. 265:20188-20194 (1990). RN [4] RX MEDLINE; 89261709. RA Garcia-Blanco M. A., Lengyel P., Morrison E., Brownlee C., Stiles C. D., RA Rutherford M., Hannigan G., Williams B. R. G. RT Regulation of 2',5'-Oligoadenylate Synthetase Gene Expression by RT Interferons and Platelet-Derived Growth Factor RL Mol. Cell. Biol. 9:1060-1068 (1989). RN [5] RX MEDLINE; 89160323. RA Cohen B., Vaiman D., Chebath J. RT Enhancer functions and in vitro protein binding of native and mutated RT interferon-responsive sequences RL Nucleic Acids Res. 17:1679-1695 (1989). XX // AC R00166 XX ID Y$BCY_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BCY (protein kinase regulating subunit); Gene: G000882. XX SQ aacaaaGCACCCAATCACCacccttg. XX S1 ATG SF -404 XX BF T00715; RAP1; Quality: 1; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM gel retardation XX CC conflict: end of SCCAPK(27:) is..acccttC XX DR EMBL: M15756; SCCAPK (27:52). XX RN [1] RX MEDLINE; 89218968. RA Buchman A. R., Lue N. F., Kornberg R. D. RT Connections between Transcriptional Activators, Silencers, and Telomeres as RT Revealed by Functional Analysis of a Yeast DNA-Binding Protein RL Mol. Cell. Biol. 8:5086-5099 (1988). XX // AC R00167 XX ID BKV$BKV_01 XX DT 20.06.1990 (created); ewi. DT 04.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BKV (human polyomavirus BK); Gene: G000030. XX SQ TTACCCATGGAATGCAGCCAAACC. XX EL e XX SF 152 ST 182 XX BF T00534; NF-1; Quality: 6; Species: monkey, Cercopithecus aethiops. BF T00539; NF-1; Quality: 6; Species: human, Homo sapiens. XX OS BKV, human polyomavirus BK OC viridae; ds-DNA nonenveloped viruses; papovaviridae; polyomaviruses XX SO 0018; 293 (hu-HEK) SO 0100; HeLa SO 0154; MK2 XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007706 DR EMBL: D00678; PAPPLYBKG (207:230). XX RN [1] RX MEDLINE; 89096938. RA Grinnell B. W., Berg D. T., Walls J. D. RT Negative Regulation of the Human Polyomavirus BK Enhancer Involves RT Cell-Specific Interaction with a Nuclear Repressor RL Mol. Cell. Biol. 8:3448-3457 (1988). XX // AC R00168 XX ID BKV$BKV_02 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE BKV (human polyomavirus BK); Gene: G000030. XX SQ ATGACTGGGCAGCCAGCCAGTGGC. XX SF 200 ST 228 XX OS BKV, human polyomavirus BK OC viridae; ds-DNA nonenveloped viruses; papovaviridae; polyomaviruses XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX DR EMBL: D00678; PAPPLYBKG (253:276). XX RN [1] RX MEDLINE; 89096938. RA Grinnell B. W., Berg D. T., Walls J. D. RT Negative Regulation of the Human Polyomavirus BK Enhancer Involves RT Cell-Specific Interaction with a Nuclear Repressor RL Mol. Cell. Biol. 8:3448-3457 (1988). XX // AC R00169 XX ID BKV$BKV_03 XX DT 20.06.1990 (created); ewi. DT 04.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BKV (human polyomavirus BK); Gene: G000030. XX SQ TACCCATGGAATGCAGCCAAACCATG. XX SF 255 ST 284 XX BF T00534; NF-1; Quality: 6; Species: monkey, Cercopithecus aethiops. BF T00539; NF-1; Quality: 6; Species: human, Homo sapiens. XX OS BKV, human polyomavirus BK OC viridae; ds-DNA nonenveloped viruses; papovaviridae; polyomaviruses XX SO 0018; 293 (hu-HEK) SO 0100; HeLa SO 0154; MK2 XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007706 DR EMBL: D00678; PAPPLYBKG (208:233). XX RN [1] RX MEDLINE; 89384609. RA Chakraborty T., Das G. C. RT Identification of HeLa Cell Nuclear Factors That Bind to and Activate the RT Early Promoter of Human Polyomavirus BK In Vitro RL Mol. Cell. Biol. 9:3821-3828 (1989). RN [2] RX MEDLINE; 89096938. RA Grinnell B. W., Berg D. T., Walls J. D. RT Negative Regulation of the Human Polyomavirus BK Enhancer Involves RT Cell-Specific Interaction with a Nuclear Repressor RL Mol. Cell. Biol. 8:3448-3457 (1988). XX // AC R00170 XX ID BKV$BKV_04 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE BKV (human polyomavirus BK); Gene: G000030. XX SQ CATGACTGGGCAGCCAGCCAGTG. XX SF 298 ST 330 XX OS BKV, human polyomavirus BK OC viridae; ds-DNA nonenveloped viruses; papovaviridae; polyomaviruses XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX DR EMBL: D00678; PAPPLYBKG (252:274). XX RN [1] RX MEDLINE; 89096938. RA Grinnell B. W., Berg D. T., Walls J. D. RT Negative Regulation of the Human Polyomavirus BK Enhancer Involves RT Cell-Specific Interaction with a Nuclear Repressor RL Mol. Cell. Biol. 8:3448-3457 (1988). XX // AC R00171 XX ID BPV1$BPV1_01 XX DT 20.06.1990 (created); ewi. DT 04.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ GAACCACACCCGGTAC. XX SF 7202 ST 7218 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0321; rec(BPV-ret lys) SO 0670; BEF XX MM DNase I footprinting MM gel retardation XX DR EMBL: X02346; PAPABPV1 (7200:7215). DR EPD: EP11206; BPV1_PL_1. DR EPD: EP11205; BPV1_PL_2. XX RN [1] RX MEDLINE; 90169511. RA Stenlund A., Botchan M. R. RT The E2 trans-activator can act as a repressor by interfering with a RT cellular transcription factor RL Genes Dev. 4:123-136 (1990). RN [2] RX MEDLINE; 91012786. RA Vande Pol S. B., Howley P. M. RT A bovine papillomavirus constitutive enhancer is negatively regulated by RT the E2 repressor through competitive binding for a cellular factor RL J. Virol. 64:5420-5429 (1990). RN [3] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00172 XX ID BPV1$BPV1_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ ACCGgcggCGGTaga. XX SF 7267 ST 7281 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM primer extension footprint MM avidin-biotin complex DNA binding assay XX DR EMBL: X02346; PAPABPV1 (7364:7378). XX RN [1] RX MEDLINE; 88211566. RA Hawley-Nelson P., Androphy E. J., Lowy D. R., Schiller J. T. RT The specific DNA recognition sequence of the bovine papillomavirus E2 RT protein is an E2-dependent enhancer RL EMBO J. 7:525-531 (1988). XX // AC R00173 XX ID BPV1$BPV1_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ GCACCGGCGGCGGTAG. XX SF 7365 ST 7380 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (7362:7377). XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00174 XX ID BPV1$BPV1_04 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ CGACCTATCCCGGTAA. XX SF 7408 ST 7423 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (7405:7420). XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00175 XX ID BPV1$BPV1_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ GGACCGAACACGTTAT. XX SF 7459 ST 7474 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (7456:7471). DR EPD: EP11207; BPV1_P79_1. XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00176 XX ID BPV1$BPV1_06 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ GAACCAGAACTGGTAA. XX SF 7510 ST 7525 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (7507:7522). DR EPD: EP11207; BPV1_P79_1. XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00177 XX ID BPV1$BPV1_07 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ ACCagtaatGGT. SQ ACCgccatcGGTgcACCgatataGGT. XX SF 7588 ST 7700 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting MM gel retardation XX DR EMBL: X02346; PAPABPV1 (7591:7602). DR EPD: EP11207; BPV1_P79_1. XX RN [1] RX MEDLINE; 88158086. RA Moskaluk C., Bastia D. RT DNA bending is induced in an enhancer by the DNA-binding domain of the RT bovine papillomavirus E2 protein RL Proc. Natl. Acad. Sci. USA 85:1826-1830 (1988). XX // AC R00178 XX ID BPV1$BPV1_08 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ CCACCAGTAATGGTGC. XX SF 7592 ST 7607 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (7589:7604). DR EPD: EP11207; BPV1_P79_1. XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00179 XX ID BPV1$BPV1_09 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ ACCagtaatGGT. XX SF 7594 ST 7637 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM primer extension footprint MM avidin-biotin complex DNA binding assay XX DR EMBL: X02346; PAPABPV1 (7591:7602). DR EPD: EP11207; BPV1_P79_1. XX RN [1] RX MEDLINE; 88211566. RA Hawley-Nelson P., Androphy E. J., Lowy D. R., Schiller J. T. RT The specific DNA recognition sequence of the bovine papillomavirus E2 RT protein is an E2-dependent enhancer RL EMBO J. 7:525-531 (1988). XX // AC R00180 XX ID BPV1$BPV1_10 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ ATCGGTGCACCGAT. XX EL enhancer XX SF 7613 ST 7639 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (7626:7639). DR EPD: EP11207; BPV1_P79_1. XX RN [1] RX MEDLINE; 87147244. RA Moskaluk C., Bastia D. RT The E2 gene of bovine papillomavirus encodes an enhancer-binding protein RL Proc. Natl. Acad. Sci. USA 84:1215-1218 (1987). XX // AC R00181 XX ID BPV1$BPV1_11 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ GTACCGCCATCGGTGC. XX SF 7621 ST 7636 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (7618:7633). DR EPD: EP11207; BPV1_P79_1. XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00182 XX ID BPV1$BPV1_12 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ GCACCGATATAGGTTT. XX SF 7635 ST 7650 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (7632:7647). DR EPD: EP11207; BPV1_P79_1. XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00183 XX ID BPV1$BPV1_13 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ TTGGGGctCCCCAA. XX EL enhancer XX SF 7637 ST 7667 XX BF T00035; AP-2alphaA; Quality: 1; Species: human, Homo sapiens. BF T02466; AP-2alphaB; Quality: 1; Species: human, Homo sapiens. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0100; HeLa XX MM DNase I footprinting MM competitive DNAse I footprint XX DR TRANSPATH: XN000009337 DR EMBL: X02346; PAPABPV1 (7646:7659). DR EPD: EP11207; BPV1_P79_1. XX RN [1] RX MEDLINE; 88027009. RA Imagawa M., Chiu R., Karin M. RT Transcription factor AP-2 mediates induction by two different signal RT transduction pathways: Protein kinase C and cAMP RL Cell 51:251-260 (1987). XX // AC R00184 XX ID BPV1$BPV1_14 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ ACCgttgccGGT. SQ ACCgtcttcGGT. XX SF 7747 ST 7840 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting MM gel retardation XX DR EMBL: J02045; PA1P (3923:3934). DR EMBL: J02045; PA1P (3944:3955). XX RN [1] RX MEDLINE; 88158086. RA Moskaluk C., Bastia D. RT DNA bending is induced in an enhancer by the DNA-binding domain of the RT bovine papillomavirus E2 protein RL Proc. Natl. Acad. Sci. USA 85:1826-1830 (1988). XX // AC R00185 XX ID BPV1$BPV1_15 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ GTACCGTTGCCGGTCG. XX SF 7761 ST 7776 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: J02045; PA1P (3921:3936). XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00186 XX ID BPV1$BPV1_16 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ AAACCGTCTTCGGTGC. XX SF 7781 ST 7796 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (7778:7793). DR EPD: EP11207; BPV1_P79_1. XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00187 XX ID BPV1$BPV1_17 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ TCACCGAAACCGGTAA. XX SF 7896 ST 7911 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (7893:7908). DR EPD: EP11207; BPV1_P79_1. XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00188 XX ID BPV1$BPV1_18 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ ACACCATCACCGTTTT. XX SF 16 ST 31 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: J02045; PA1P (4123:4138). XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00189 XX ID BPV1$BPV1_19 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ CAAACGATAAAGGTAG. XX SF 855 ST 870 XX BF T00205; E2; Quality: 6; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (853:868). XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00190 XX ID BPV1$BPV1_20 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ AAAACAGCAGCGGTTC. XX SF 1125 ST 1140 XX BF T00205; E2; Quality: 2; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (1123:1138). XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00191 XX ID BPV1$BPV1_21 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX RE P4 promoter XX SQ CTCCACCCCTCCTGGTAA. XX SF 2396 ST 2411 XX BF T00205; E2; Quality: 2; Species: BPV-1, bovine papilloma virus type 1. BF T00759; Sp1; Quality: 2; Species: human, Homo sapiens. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0100; HeLa SO 0321; rec(BPV-ret lys) XX MM DNase I footprinting XX CC Sp1 and E2 activate synergistically XX DR EMBL: X02346; PAPABPV1 (2392:2409). DR EPD: EP11209; BPV1_P24. XX RN [1] RX MEDLINE; 91208686. RA Li R., Knight J. D., Jackson S. P., Tijan R., Botchan M. R. RT Direct interaction between Sp1 and the BPV Enhancer E2 protein mediates RT synergistic activation of transcription RL Cell 65:493-505 (1991). RN [2] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00192 XX ID BPV1$BPV1_22 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ AGAACCTAAACGGTGC. XX SF 2921 ST 2936 XX BF T00205; E2; Quality: 2; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (2919:2934). DR EPD: EP11210; BPV1_P30. XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00193 XX ID BPV1$BPV1_23 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BPV-1 (bovine papilloma virus-1); Gene: G000040. XX SQ GCACCATGGCCGGTGC. XX SF 3088 ST 3103 XX BF T00205; E2; Quality: 2; Species: BPV-1, bovine papilloma virus type 1. XX OS BPV-1, bovine papilloma virus type 1 OC viridae; ds-DNA nonenveloped viruses; papovaviridae; papillomavirus XX SO 0680; rec(BPV-E.coli) XX MM DNase I footprinting XX DR EMBL: X02346; PAPABPV1 (3086:3101). DR EPD: EP11210; BPV1_P30. XX RN [1] RX MEDLINE; 89252826. RA Li R., Knight J., Bream G., Stenlund A., Botchan M. RT Specific recognition nucleotides and their DNA context determine the RT affinity of E2 protein for 17 binding sites in the BPV-1 genome RL Genes Dev. 3:510-526 (1989). XX // AC R00194 XX ID EBV$BRLF1_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BRLF1; Gene: G000135. XX SQ TTATTTTGGTTCCT. XX EL RI XX SF -160 ST -147 XX BF T00492; MBF1; Quality: 6; Species: human, Homo sapiens. XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0179; Ramos XX MM DNase I footprinting MM competitive DNAse I footprint XX DR TRANSPATH: XN000007658 DR EMBL: V01555; EBV (106327:106340). XX RN [1] RX MEDLINE; 90156519. RA Flemington E., Speck S. H. RT Identification of Phorbol Ester Responsive Elements in the Promoter of RT Epstein-Barr Virus Putative Lytic Switch Gene BZLF1 RL J. Virol. 64:1217-1226 (1990). XX // AC R00195 XX ID EBV$BRLF1_02 XX DT 20.06.1990 (created); ewi. DT 31.08.1995 (updated); dbo. CO Copyright (C), Biobase GmbH. XX TY D XX DE BRLF1; Gene: G000135. XX SQ CCCTGACCATCACATGGGGCATT. XX EL RII XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0179; Ramos XX MM DNase I footprinting XX DR EMBL: V01555; EBV (106250:106272). XX RN [1] RX MEDLINE; 90156519. RA Flemington E., Speck S. H. RT Identification of Phorbol Ester Responsive Elements in the Promoter of RT Epstein-Barr Virus Putative Lytic Switch Gene BZLF1 RL J. Virol. 64:1217-1226 (1990). XX // AC R00196 XX ID EBV$BSLF2_01 XX DT 20.06.1990 (created); ewi. DT 21.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BSLF2 + BMLF1 (BC-R2 promoter); Gene: G000137. XX RE BC-R2 promoter XX SQ gaagcacTGACTCAtgaa. XX SF 84425 ST 84439 XX BF T00923; Zta; Quality: 1; Species: EBV, Epstein-Barr virus. XX MX M00711; V$ZTA_Q2 XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0302; rec(EBV-E.coli) SO 0330; rec(EBV-ret lys) XX MM DNase I footprinting MM functional analysis MM direct gel shift XX DR EMBL: V01555; EBV (84422:84439). XX RN [1] RX MEDLINE; 92085440. RA Sinclair A. J., Brimmell M., Farrell P. J. RT Reciprocal antagonism of steroid hormones and BZLF1 in switch between RT Epstein-Barr virus latent and productive cycle gene expression RL J. Virol. 66:70-77 (1992). RN [2] RX MEDLINE; 91303651. RA Taylor N., Flemington E., Kolman J. L., Baumann R. P., Speck S. H., Miller RA G. RT ZEBRA and a Fos-GCN4 chimeric protein differ in their DNA-binding RT specificities for sites in the Epstein-Barr virus BZLF1 promoter RL J. Virol. 65:4033-4041 (1991). RN [3] RX MEDLINE; 91237800. RA Young L. S., Lau R., Rowe M., Niedobitek G., Packham G., Shanahan F., Rowe RA D. T., Greenspan D., Greenspan J. S., Rickinson A. B., Farrell P. J. RT Differentiation-associated expression of the Epstein-Barr BZLF1 RT transactivator protein in oral hairy leukoplakia RL J. Virol. 65:2868-2874 (1991). RN [4] RX MEDLINE; 89231610. RA Farrell P. J., Rowe D. T., Rooney C. M., Kouzarides T. RT Epstein-Barr virus BZLF1 trans-activator specifically binds to a consensus RT AP-1 site and is related to c-fos RL EMBO J. 8:127-132 (1989). XX // AC R00197 XX ID EBV$BZLF1_01 XX DT 20.06.1990 (created); ewi. DT 12.03.2001 (updated); dkl. CO Copyright (C), Biobase GmbH. XX TY D XX DE BZLF1; Gene: G000138. XX SQ TGTCTAAAATAAgcTGGTGTCAAAAATAG. XX EL ZIA/ZIB XX SF -200 ST -165 XX BF T00492; MBF1; Quality: 6; Species: human, Homo sapiens. BF T01005; MEF-2; Quality: 6; Species: human, Homo sapiens. XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0051; Cl-13 SO 0179; Ramos SO 1103; DG75 XX MM DNase I footprinting MM direct gel shift MM supershift (antibody binding) XX CC ZIA-Sequence: TCAAAAATAG; ZIB-Sequence: CTAAAATAAG XX DR TRANSPATH: XN000005734 DR TRANSPATH: XN000007656 DR EMBL: V01555; EBV (103363:103391). DR EMBL: M20820; HEHS4HET (1445:1473). DR EPD: EP26014; EBV_YRR1. XX RN [1] RX MEDLINE; 97162288. RA Liu S., Liu P., Borras A., Chatila T., Speck S. H. RT Cyclosporin A-sensitive induction of the Epstein-Barr virus lytic switch is RT mediated via a novel pathway involving a MEF2 family receptor RL EMBO J. 16:143-153 (1997). RN [2] RX MEDLINE; 90156519. RA Flemington E., Speck S. H. RT Identification of Phorbol Ester Responsive Elements in the Promoter of RT Epstein-Barr Virus Putative Lytic Switch Gene BZLF1 RL J. Virol. 64:1217-1226 (1990). XX // AC R00198 XX ID EBV$BZLF1_02 XX DT 20.06.1990 (created); ewi. DT 22.08.2000 (updated); dkl. CO Copyright (C), Biobase GmbH. XX TY D XX DE BZLF1; Gene: G000138. XX RE promoter XX SQ TAGTTTCTAAAAGAG. XX EL ZIC XX SF -157 ST -133 XX BF T00492; MBF1; Quality: 6; Species: human, Homo sapiens. BF T01005; MEF-2; Quality: 6; Species: human, Homo sapiens. XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0051; Cl-13 SO 0179; Ramos XX MM DNase I footprinting XX DR TRANSPATH: XN000005734 DR TRANSPATH: XN000007656 DR EMBL: V01555; EBV (103328:103342). DR EPD: EP26014; EBV_YRR1. XX RN [1] RX MEDLINE; 90156519. RA Flemington E., Speck S. H. RT Identification of Phorbol Ester Responsive Elements in the Promoter of RT Epstein-Barr Virus Putative Lytic Switch Gene BZLF1 RL J. Virol. 64:1217-1226 (1990). XX // AC R00199 XX ID EBV$BZLF1_03 XX DT 20.06.1990 (created); ewi. DT 09.07.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE BZLF1; Gene: G000138. XX SQ CTCTGTGATGTCATGGTTT. SQ CTAAATTTAGGTGTG. XX EL ZID/ZII XX SF -98 ST -55 XX BF T00123; c-Fos; Quality: 6; Species: human, Homo sapiens. BF T00133; c-Jun; Quality: 6; Species: human, Homo sapiens. BF T00492; MBF1; Quality: 6; Species: human, Homo sapiens. BF T01005; MEF-2; Quality: 6; Species: human, Homo sapiens. XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0051; Cl-13 SO 0179; Ramos SO 0678; rec(rat-) XX MM DNase I footprinting XX DR TRANSPATH: XN000005734 DR TRANSPATH: XN000005735 DR TRANSPATH: XN000005736 DR TRANSPATH: XN000007656 DR EMBL: V01555; EBV (103249:103267). DR EPD: EP26014; EBV_YRR1. XX RN [1] RX MEDLINE; 90156519. RA Flemington E., Speck S. H. RT Identification of Phorbol Ester Responsive Elements in the Promoter of RT Epstein-Barr Virus Putative Lytic Switch Gene BZLF1 RL J. Virol. 64:1217-1226 (1990). XX // AC R00200 XX ID Y$CFES_01 XX DT 20.06.1990 (created); ewi. DT 29.08.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CIII-FeS (QH2:cytochrome C oxidoreductase iron-sulfur subunit); Gene: DE G000895. XX SQ GTCACGTG. XX S1 ATG SF -321 ST 204 XX BF T00324; GFII; Quality: 4; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM gel retardation XX DR EMBL: M23316; SCRIP101 (110:117). XX RN [1] RX MEDLINE; 88319925. RA Dorsman J. C., van Heeswijk W. C., Grivell L. A. RT Identification of two factors which bind to the upstream sequences of a RT number of nuclear genes coding for mitochondrial proteins and to genetic RT elements important for cell division in yeast RL Nucleic Acids Res. 16:7287-7301 (1988). XX // AC R00201 XX ID Y$CSII_01 XX DT 20.06.1990 (created); ewi. DT 31.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CIII-sub II (QH2:cytochrome C oxidoreductase subunit II); Gene: G000896. XX SQ CTGATCATTCCCAACGAACCAATAG. XX S1 ATG SF -203 ST -179 XX BF T01294; GFI; Quality: 6; Species: yeast, Kluyveromyces lactis. BF T00778; TAF; Quality: 2; Species: yeast, Saccharomyces cerevisiae. XX MX M00703; F$TAF_Q6 XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast SO 0615; Kl.lactis XX MM DNase I footprinting MM gel retardation XX DR EMBL: X05120; SCCOXCH2 (307:331). XX RN [1] RX MEDLINE; 90251453. RA Dorsman J. C., van Heeswijk W. C., Grivell L. A. RT Yeast general transcription factor GFI: sequence requirements for binding RT to DNA and evolutionary conservation RL Nucleic Acids Res. 18:2769-2776 (1990). RN [2] RX MEDLINE; 89345059. RA Dorsman J. C., Doorenbosch M. M., Maurer C. T. C., de Winde J. H., Mager W. RA H., Planta J. R., Grivell L. A. RT An ARS/silencer binding factor also activates two ribosomal protein genes RT in yeast RL Nucleic Acids Res. 17:4917 (1989). RN [3] RX MEDLINE; 88319925. RA Dorsman J. C., van Heeswijk W. C., Grivell L. A. RT Identification of two factors which bind to the upstream sequences of a RT number of nuclear genes coding for mitochondrial proteins and to genetic RT elements important for cell division in yeast RL Nucleic Acids Res. 16:7287-7301 (1988). XX // AC R00202 XX ID Y$CSVI_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CIII-sub VI (QH2:cytochrome C oxidoreductase subunit VI); Gene: G000897. XX S1 ATG SF -489 ST -131 XX BF T00324; GFII; Quality: 4; Species: yeast, Saccharomyces cerevisiae. BF T00778; TAF; Quality: 4; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM gel retardation XX RN [1] RX MEDLINE; 88319925. RA Dorsman J. C., van Heeswijk W. C., Grivell L. A. RT Identification of two factors which bind to the upstream sequences of a RT number of nuclear genes coding for mitochondrial proteins and to genetic RT elements important for cell division in yeast RL Nucleic Acids Res. 16:7287-7301 (1988). XX // AC R00203 XX ID Y$CSVIII_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CIII-sub VIII (QH2:cytochrome C oxidoreductase subunit VIII); Gene: G000898. XX S1 ATG SF -274 ST 7 XX BF T00324; GFII; Quality: 4; Species: yeast, Saccharomyces cerevisiae. BF T00778; TAF; Quality: 4; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM gel retardation XX RN [1] RX MEDLINE; 88319925. RA Dorsman J. C., van Heeswijk W. C., Grivell L. A. RT Identification of two factors which bind to the upstream sequences of a RT number of nuclear genes coding for mitochondrial proteins and to genetic RT elements important for cell division in yeast RL Nucleic Acids Res. 16:7287-7301 (1988). XX // AC R00204 XX ID Y$CSVIII_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CIII-sub VIII (QH2:cytochrome C oxidoreductase subunit VIII); Gene: G000898. XX SQ ACCGTTCCACGTGACTAG. XX S1 ATG SF -248 ST -231 XX BF T00778; TAF; Quality: 4; Species: yeast, Saccharomyces cerevisiae. XX MX M00703; F$TAF_Q6 XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM gel retardation XX DR EMBL: X05550; SCUBCOX8 (911:928). XX RN [1] RX MEDLINE; 88319925. RA Dorsman J. C., van Heeswijk W. C., Grivell L. A. RT Identification of two factors which bind to the upstream sequences of a RT number of nuclear genes coding for mitochondrial proteins and to genetic RT elements important for cell division in yeast RL Nucleic Acids Res. 16:7287-7301 (1988). XX // AC R00205 XX ID RAT$CAPEPA_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE cbxpa (carboxypeptidase A); Gene: G000719. XX SQ CCCCATGGGACTTGATCCAGATGTGAGG. XX SF -84 ST -68 XX BF T00701; PTF1-beta; Quality: 6; Species: rat, Rattus norvegicus. XX MX M00657; V$PTF1BETA_Q6 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0028; AR42J XX MM methylation protection MM methylation interference XX DR TRANSPATH: XN000007943 DR EMBL: J00713; RNCBXPA (208:235). XX RN [1] RX MEDLINE; 89343964. RA Cockell M., Stevenson B. J., Strubin M., Hagenbuechle O., Wellauer P. K. RT Identification of a Cell-Specific DNA-Binding Activity That Interacts with RT a Transcriptional Activator of Genes Expressed in the Acinar Pancreas RL Mol. Cell. Biol. 9:2464-2476 (1989). XX // AC R00206 XX ID Y$CDC9_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE cdc9 (cell division cycle gene 9); Gene: G000889. XX SQ TTCATCATTACCCGGATGAT. XX SF -84 ST -68 XX BF T00725; REB1; Quality: 1; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM gel retardation XX DR EMBL: X03246; SCCDC9 (354:373). XX RN [1] RX MEDLINE; 90205855. RA Wang H., Nicholson P. R., Stillman D. J. RT Identification of a Saccharomyces cerevisiae DNA-binding protein involved RT in transcriptional regulation RL Mol. Cell. Biol. 10:1743-1753 (1990). XX // AC R00207 XX ID AS$CEBP_01 XX DT 20.06.1990 (created); ewi. DT 14.11.1997 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE artificial sequence. XX SQ tgcagATTGCGCAATctgca. XX BF T01303; ATF4; Quality: 2; Species: human, Homo sapiens. BF T00108; C/EBPalpha; Quality: 2; Species: rat, Rattus norvegicus. BF T00017; C/EBPbeta; Quality: 2; Species: mouse, Mus musculus. BF T00459; C/EBPbeta; Quality: 2; Species: rat, Rattus norvegicus. BF T01114; C/EBPdelta; Quality: 2; Species: mouse, Mus musculus. BF T00171; C/EBPepsilon; Quality: 2; Species: rat, Rattus norvegicus. BF T00216; C/EBPgamma; Quality: 2; Species: mouse, Mus musculus. BF T00183; DBP; Quality: 2; Species: rat, Rattus norvegicus. XX MX M00514; V$ATF4_Q2 XX SO 0301; rec(rat-E.coli) SO 0303; rec(mouse-E.coli) SO 0306; rec(human-E.coli) XX MM DNase I footprinting MM hydroxyl radicals MM direct gel shift MM methylation protection XX CC ATF-4 does not bind alone; C/EBPalpha binds only in the nonphosphorylated CC state [2] XX RN [1] RX MEDLINE; 93279464. RA Vinson C. R., Hai T., Boyd S. M. RT Dimerization specificity of the leucine zipper-containing bZIP motif on DNA RT binding: prediction and rational design RL Genes Dev. 7:1047-1058 (1993). RN [2] RX MEDLINE; 92406888. RA Mahoney C. W., Shuman J., McKnight S. L., Chen H. C., Huang K. P. RT Phosphorylation of CCAAT-enhancer binding protein by protein kinase C RT attenuates site-selective DNA binding RL J. Biol. Chem. 267:19396-19403 (1992). RN [3] RX MEDLINE; 91357470. RA Cao Z., Umek R. M., McKnight S. L. RT Regulated expression of three C/EBP isoforms during adipose conversion of RT 3T3-L1 cells RL Genes Dev. 5:1538-1552 (1991). RN [4] RX MEDLINE; 90049224. RA Vinson C. R., Sigler P. B., McKnight S. L. RT Scissors-grip model for DNA recognition by a family of leucine zipper RT proteins RL Science 246:911-916 (1989). XX // AC R00208 XX ID Y$CEN4_01 XX DT 20.06.1990 (created); ewi. DT 16.11.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE CEN IV (centromeric region of chromosome IV); Gene: G000890. XX SQ ATCACGTG. XX EL CDE I XX BF T01293; GFII; Quality: 5; Species: yeast, Kluyveromyces lactis. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0615; Kl.lactis XX MM gel retardation XX DR EMBL: X65523; KLCEN4 (356:363). XX RN [1] RX MEDLINE; 90251453. RA Dorsman J. C., van Heeswijk W. C., Grivell L. A. RT Yeast general transcription factor GFI: sequence requirements for binding RT to DNA and evolutionary conservation RL Nucleic Acids Res. 18:2769-2776 (1990). XX // AC R00209 XX ID PARS$CHS_01 XX DT 20.06.1990 (created); ewi. DT 26.10.2001 (updated); rge. CO Copyright (C), Biobase GmbH. XX TY D XX DE CHS (chalcone synthase); Gene: G000658. XX SQ ACGTGGA. XX EL box III XX SF -234 ST -230 XX OS parsley, Petroselinum crispum (P. hortense) OC eukaryota; viridiplantae; embryobionta; magnoliophyta; magnoliopsida; OC rosidae; apiales; apiaceae XX SO 0502; dipl. parsley + XX MM in vivo / genomic methylation protection XX DR EMBL: M35516; PCCHSA2 (401:407). XX RN [1] RX MEDLINE; 89251593. RA Schulze-Lefert P., Dangl J. L., Becker-Andre M., Hahlbrock K., Schulz W. RT Inducible in vivo DNA footprints define sequences necessary for UV light RT activation of the parsley chalcone synthase gene RL EMBO J. 8:651-656 (1989). XX // AC R00210 XX ID PARS$CHS_02 XX DT 20.06.1990 (created); ewi. DT 26.10.2001 (updated); rge. CO Copyright (C), Biobase GmbH. XX TY D XX DE CHS (chalcone synthase); Gene: G000658. XX RE promoter XX SQ TCCACGTGGC. XX EL box II, ACE (ACGT containing element) XX SF -168 ST -161 XX BF T00126; CG-1; Quality: 6; Species: tobacco, Nicotiana tabacum. BF T01091; CPRF-1; Quality: 1; Species: parsley, Petroselinum crispum (P. BF hortense). BF T01092; CPRF-2; Quality: 2; Species: parsley, Petroselinum crispum (P. BF hortense). BF T02677; CPRF-4a; Quality: 2; Species: parsley, Petroselinum crispum (P. BF hortense). BF T02678; CPRF-4b; Quality: 2; Species: parsley, Petroselinum crispum (P. BF hortense). XX MX M00440; P$CG1_Q6 XX OS parsley, Petroselinum crispum (P. hortense) OC eukaryota; viridiplantae; embryobionta; magnoliophyta; magnoliopsida; OC rosidae; apiales; apiaceae XX SO 0460; N. tabacum + UV SO 0502; dipl. parsley + SO 0553; rec(parsley-ret lys) XX MM functional analysis MM supershift (antibody binding) MM gel shift competition MM in vivo / genomic methylation protection XX CC box I and box II are required for light dependent CC expression; binding activity induced by UV-irradiation [7]; overexpression CC of CPRF-1 reduced light-dependent transcription [2]; selektive CC heterodimerization leads to high affinity in vitro binding of CPRF-1/CPRF4 CC [3] XX DR EMBL: M35516; PCCHSA2 (467:476). XX RN [1] RX MEDLINE; 98265918. RA Kircher S., Ledger S., Hayashi H., Weisshaar B., Schaefer E., Frohnmeyer H. RT CPRF4, a novel plant bZIP protein of the CPRF family: comparative analysis RT of their light dependent expression, post-transcriptional regulation, RT nuclear import and heterodimerization RL Mol. Gen. Genet. 257:595-605 (1998). RN [2] RX MEDLINE; 95128172. RA Feldbruegge M., Sprenger M., Dinkelbach M., Yazaki K., Harter K., Weisshaar RA B. RT Functional analysis of a light-responsive plant bZIP transcriptional RT regulator RL Plant Cell 6:1607-1621 (1994). RN [3] RX MEDLINE; 93253774. RA Izawa T., Foster R., Chua N.-H. RT Plant bZIP protein DNA binding specificity. RL J. Mol. Biol. 230:1131-1144 (1993). RN [4] RX MEDLINE; 91266906. RA Weisshaar B., Armstrong G. A., Block A., da Costa e Silva O., Halbrock K. RT Light-inducible and constitutively expressed DNA-binding proteins RT recognizing a plant promoter element with functional relevance in light RT responsiveness RL EMBO J. 12:1777-1786 (1991). RN [5] RX MEDLINE; 90319118. RA Block A., Dangl J. L., Hahlbrock K., Schulze-Lefert P. RT Functional borders, genetic fine structure, and distance requirements of RT cis elements mediating light responsiveness of the parsley chalcone RT synthase promoter RL Proc. Natl. Acad. Sci. USA 87:5387-5391 (1990). RN [6] RX MEDLINE; 89251593. RA Schulze-Lefert P., Dangl J. L., Becker-Andre M., Hahlbrock K., Schulz W. RT Inducible in vivo DNA footprints define sequences necessary for UV light RT activation of the parsley chalcone synthase gene RL EMBO J. 8:651-656 (1989). RN [7] RX MEDLINE; 89386653. RA Staiger D., Kaulen H., Schell J. RT A CACGTG motif of the Antirrhinum majus chalcone synthase promoter is RT recognized by an evolutionarily conserved nuclear protein RL Proc. Natl. Acad. Sci. USA 86:6930-6934 (1989). XX // AC R00211 XX ID PARS$CHS_03 XX DT 20.06.1990 (created); ewi. DT 31.07.2000 (updated); rge. CO Copyright (C), Biobase GmbH. XX TY D XX DE CHS (chalcone synthase); Gene: G000658. XX RE promotor XX SQ AACCTAACCT. XX EL MRE, box I XX SF -147 ST -131 XX BF T02876; MYB1; Quality: 1; Species: parsley, Petroselinum crispum (P. BF hortense). BF T02907; MYB305; Quality: 1; Species: garden snapdragon, Antirrhinum majus. XX OS parsley, Petroselinum crispum (P. hortense) OC eukaryota; viridiplantae; embryobionta; magnoliophyta; magnoliopsida; OC rosidae; apiales; apiaceae XX SO 0502; dipl. parsley + SO 1008; rec(parsley-E.coli) SO 1009; rec(snapdragon-E.coli) XX MM functional analysis MM direct gel shift MM supershift (antibody binding) MM gel shift competition MM in vivo / genomic methylation protection MM nitrocellulose filter binding XX CC box I and box II are required for light dependent CC expression [3] XX DR EMBL: M35516; PCCHSA2 (497:506). XX RN [1] RX MEDLINE; 97336301. RA Feldbrugge M., Sprenger M., Hahlbrock K., Weisshaar B. RT PcMYB1, a novel plant protein containing a DNA-binding domain with one MYB RT repeat, interacts in vivo with a light-regulatory promoter unit RL Plant J. 11:1079-1093 (1997). RN [2] RX MEDLINE; 93005689. RA Jackson D., Culianez-Macia F., Prescott A. G., Roberts K., Martin C. RT Expression patterns of myb genes from Antirrhinum flowers RL Plant Cell 3:115-125 (1991). RN [3] RX MEDLINE; 90319118. RA Block A., Dangl J. L., Hahlbrock K., Schulze-Lefert P. RT Functional borders, genetic fine structure, and distance requirements of RT cis elements mediating light responsiveness of the parsley chalcone RT synthase promoter RL Proc. Natl. Acad. Sci. USA 87:5387-5391 (1990). RN [4] RX MEDLINE; 89251593. RA Schulze-Lefert P., Dangl J. L., Becker-Andre M., Hahlbrock K., Schulz W. RT Inducible in vivo DNA footprints define sequences necessary for UV light RT activation of the parsley chalcone synthase gene RL EMBO J. 8:651-656 (1989). XX // AC R00215 XX ID CHICK$HOX14_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Chox-1.4; Gene: G000055. XX SQ AGAAAAATTAGTATTTTT. XX EL site 1.4-1; downstream of cap site XX BF T00128; HOXA4; Quality: 2; Species: chick, Gallus gallus. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0315; rec(chick-E.coli) XX MM DNase I footprinting MM avidin-biotin complex DNA binding assay XX DR EMBL: X52670; GGCHOX14 (33:50). XX RN [1] RX MEDLINE; 90245562. RA Sasaki H., Yokoyama E., Kuroiwa A. RT Specific DNA binding of the two chicken Deformed family homeodomain RT proteins, Chox-1.4 and Chox-a RL Nucleic Acids Res. 18:1739-1747 (1990). XX // AC R00216 XX ID CHICK$HOX14_02 XX DT 20.06.1990 (created); ewi. DT 31.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Chox-1.4; Gene: G000055. XX SQ AATTAATGACCA. XX EL site 1.4-2; downstream of cap site XX BF T00128; HOXA4; Quality: 2; Species: chick, Gallus gallus. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0315; rec(chick-E.coli) XX MM DNase I footprinting MM avidin-biotin complex DNA binding assay XX DR EMBL: X52670; GGCHOX14 (61:72). XX RN [1] RX MEDLINE; 90245562. RA Sasaki H., Yokoyama E., Kuroiwa A. RT Specific DNA binding of the two chicken Deformed family homeodomain RT proteins, Chox-1.4 and Chox-a RL Nucleic Acids Res. 18:1739-1747 (1990). XX // AC R00217 XX ID CHICK$CHOXA_01 XX DT 20.06.1990 (created); ewi. DT 31.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Chox-a; Gene: G000056. XX SQ AACCCAATTAGAA. XX EL site a-1 XX BF T00128; HOXA4; Quality: 2; Species: chick, Gallus gallus. XX MX M00640; V$HOXA4_Q2 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0315; rec(chick-E.coli) XX MM DNase I footprinting MM avidin-biotin complex DNA binding assay XX CC conflict: GGCHOXA(378:) is aacccCaattaCa XX DR EMBL: X52672; GGCHOXA (378:390). XX RN [1] RX MEDLINE; 90245562. RA Sasaki H., Yokoyama E., Kuroiwa A. RT Specific DNA binding of the two chicken Deformed family homeodomain RT proteins, Chox-1.4 and Chox-a RL Nucleic Acids Res. 18:1739-1747 (1990). XX // AC R00218 XX ID CHICK$CHOXA_02 XX DT 20.06.1990 (created); ewi. DT 31.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Chox-a; Gene: G000056. XX SQ AGTGCAATTGGCT. XX EL site a-1' XX BF T00128; HOXA4; Quality: 2; Species: chick, Gallus gallus. XX MX M00640; V$HOXA4_Q2 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0315; rec(chick-E.coli) XX MM DNase I footprinting MM avidin-biotin complex DNA binding assay XX RN [1] RX MEDLINE; 90245562. RA Sasaki H., Yokoyama E., Kuroiwa A. RT Specific DNA binding of the two chicken Deformed family homeodomain RT proteins, Chox-1.4 and Chox-a RL Nucleic Acids Res. 18:1739-1747 (1990). XX // AC R00219 XX ID CHICK$CHOXA_03 XX DT 20.06.1990 (created); ewi. DT 31.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Chox-a; Gene: G000056. XX SQ TTCTCGTTATCT. XX EL site a-1'' XX BF T00128; HOXA4; Quality: 2; Species: chick, Gallus gallus. XX MX M00640; V$HOXA4_Q2 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0315; rec(chick-E.coli) XX MM DNase I footprinting MM avidin-biotin complex DNA binding assay XX RN [1] RX MEDLINE; 90245562. RA Sasaki H., Yokoyama E., Kuroiwa A. RT Specific DNA binding of the two chicken Deformed family homeodomain RT proteins, Chox-1.4 and Chox-a RL Nucleic Acids Res. 18:1739-1747 (1990). XX // AC R00220 XX ID CHICK$CHOXA_04 XX DT 20.06.1990 (created); ewi. DT 31.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Chox-a; Gene: G000056. XX SQ ACTGATTGCCTAATTTTA. XX EL site a-2 XX BF T00128; HOXA4; Quality: 2; Species: chick, Gallus gallus. XX MX M00640; V$HOXA4_Q2 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0315; rec(chick-E.coli) XX MM DNase I footprinting MM avidin-biotin complex DNA binding assay XX RN [1] RX MEDLINE; 90245562. RA Sasaki H., Yokoyama E., Kuroiwa A. RT Specific DNA binding of the two chicken Deformed family homeodomain RT proteins, Chox-1.4 and Chox-a RL Nucleic Acids Res. 18:1739-1747 (1990). XX // AC R00221 XX ID CHICK$CHOXA_05 XX DT 20.06.1990 (created); ewi. DT 31.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Chox-a; Gene: G000056. XX SQ AGAAAAATTAGTATTTTC. XX EL site a-3; downstream of cap site XX BF T00128; HOXA4; Quality: 2; Species: chick, Gallus gallus. XX MX M00640; V$HOXA4_Q2 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0315; rec(chick-E.coli) XX MM DNase I footprinting MM avidin-biotin complex DNA binding assay XX RN [1] RX MEDLINE; 90245562. RA Sasaki H., Yokoyama E., Kuroiwa A. RT Specific DNA binding of the two chicken Deformed family homeodomain RT proteins, Chox-1.4 and Chox-a RL Nucleic Acids Res. 18:1739-1747 (1990). XX // AC R00222 XX ID CHICK$CHOXA_06 XX DT 20.06.1990 (created); ewi. DT 31.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Chox-a; Gene: G000056. XX SQ AATTAATGGCCA. XX EL site a-4; downstream of cap site XX BF T00128; HOXA4; Quality: 2; Species: chick, Gallus gallus. XX MX M00640; V$HOXA4_Q2 XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0315; rec(chick-E.coli) XX MM DNase I footprinting MM avidin-biotin complex DNA binding assay XX RN [1] RX MEDLINE; 90245562. RA Sasaki H., Yokoyama E., Kuroiwa A. RT Specific DNA binding of the two chicken Deformed family homeodomain RT proteins, Chox-1.4 and Chox-a RL Nucleic Acids Res. 18:1739-1747 (1990). XX // AC R00223 XX ID RAT$CHYB_01 XX DT 20.06.1990 (created); ewi. DT 13.07.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ChymB (chymotrypsinogen B); Gene: G000723. XX SQ CAGGGCACCTGTCCTTTTCCCATGGCC. XX SF -208 ST -192 XX BF T00675; E12; Quality: 6; Species: rat, Rattus norvegicus. BF T01787; E12; Quality: 6; Species: clawed frog, Xenopus laevis. BF T00674; E47; Quality: 6; Species: rat, Rattus norvegicus. BF T01788; E47; Quality: 6; Species: mouse, Mus musculus. BF T01227; PTF1; Quality: 6; Species: mouse, Mus musculus. BF T00701; PTF1-beta; Quality: 6; Species: rat, Rattus norvegicus. BF T00906; XPF-1; Quality: 6; Species: dog, Canis canis. XX MX M00657; V$PTF1BETA_Q6 MX M00684; V$XPF1_Q6 MX M00693; V$E12_Q6 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0017; 266-6 SO 0028; AR42J SO 0320; rec(rat-ret lys) SO 0410; pancreas XX MM DNase I footprinting MM gel retardation MM methylation protection MM methylation interference XX DR TRANSPATH: XN000007896 DR TRANSPATH: XN000007897 DR TRANSPATH: XN000007944 DR TRANSPATH: XN000008308 DR TRANSPATH: XN000008670 DR TRANSPATH: XN000009014 DR TRANSPATH: XN000009016 DR EMBL: K02298; RNCTRPB (500:526). DR EPD: EP16053; RN_CTRB. XX RN [1] RX MEDLINE; 92017774. RA Weinrich S. L., Meister A., Rutter W. J. RT Exocrine pancreas transcription factor 1 binds to a bipartite enhancer RT element and activates transcription of acinar genes RL Mol. Cell. Biol. 11:4985-4997 (1991). RN [2] RX MEDLINE; 90346284. RA Nelson C., Shen L.-P., Meister A., Fodor E., Rutter W. J. RT Pan: a transcriptional regulator that binds chymotrypsin, insulin, and AP-4 RT enhancer motifs RL Genes Dev. 4:1035-1043 (1990). RN [3] RX MEDLINE; 90062221. RA Meister A., Weinrich S. L., Nelson C., Rutter W. J. RT The Chymotrypsin Enhancer Core: specific factor binding and biological RT activity RL J. Biol. Chem. 264:20744-20751 (1989). RN [4] RX MEDLINE; 89343964. RA Cockell M., Stevenson B. J., Strubin M., Hagenbuechle O., Wellauer P. K. RT Identification of a Cell-Specific DNA-Binding Activity That Interacts with RT a Transcriptional Activator of Genes Expressed in the Acinar Pancreas RL Mol. Cell. Biol. 9:2464-2476 (1989). XX // AC R00224 XX ID HS$A11COL_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE A1(1) COL (alpha1 (I) collagen); Gene: G000198. XX SQ GCCCCGCCCC. XX SF 919 ST 944 XX BF T00759; Sp1; Quality: 5; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0036; BJA-B SO 0100; HeLa XX MM DNase I footprinting XX DR EMBL: M20789; HSC1A1 (924:933). DR EMBL: J02829; HSCG1A1P (1173:1182). DR EMBL: J03559; HSCOLA1I (1729:1738). XX RN [1] RX MEDLINE; 88097389. RA Bornstein P., McKay J., Morishima J. K., Devarayalu S., Gelinas R. E. RT Regulatory elements in the first intron contribute to transcriptional RT control of the human alpha1(I) collagen gene RL Proc. Natl. Acad. Sci. USA 84:8869-8873 (1987). XX // AC R00225 XX ID HS$A11COL_02 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE A1(1) COL (alpha1 (I) collagen); Gene: G000198. XX SQ GTGGTTAGC. XX SF 950 ST 1009 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0036; BJA-B SO 0100; HeLa XX MM DNase I footprinting XX DR EMBL: M20789; HSC1A1 (998:1006). XX RN [1] RX MEDLINE; 88097389. RA Bornstein P., McKay J., Morishima J. K., Devarayalu S., Gelinas R. E. RT Regulatory elements in the first intron contribute to transcriptional RT control of the human alpha1(I) collagen gene RL Proc. Natl. Acad. Sci. USA 84:8869-8873 (1987). XX // AC R00226 XX ID HS$A11COL_03 XX DT 20.06.1990 (created); ewi. DT 03.05.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE A1(1) COL (alpha1 (I) collagen); Gene: G000198. XX SF -477 ST -255 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0388; fibroblasts XX MM gel shift competition XX CC same factor binding as to the 1st intron element XX RN [1] RX MEDLINE; 89096858. RA Bornstein P., McKay J., Liska D. J., Apone S., Devarayalu S. RT Interaction between the Promoter and First Intron are Involved in RT Transcriptional Control of alpha1(I) Collagen Gene Expression RL Mol. Cell. Biol. 8:4851-4857 (1988). XX // AC R00227 XX ID HS$A11COL_04 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE A1(1) COL (alpha1 (I) collagen); Gene: G000198. XX RE 1st intron XX SF 820 ST 1093 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0388; fibroblasts XX MM gel retardation XX RN [1] RX MEDLINE; 89096858. RA Bornstein P., McKay J., Liska D. J., Apone S., Devarayalu S. RT Interaction between the Promoter and First Intron are Involved in RT Transcriptional Control of alpha1(I) Collagen Gene Expression RL Mol. Cell. Biol. 8:4851-4857 (1988). XX // AC R00228 XX ID MOUSE$A11COL_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE A1(1) COL (alpha1(I) collagen); Gene: G000469. XX SQ caggcagttctgATTGGctGGGGGCCGGG. XX SF -113 ST -84 XX BF T00083; CBF (2); Quality: 6; Species: mouse, Mus musculus. BF T00409; IF2; Quality: 6; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0003; 3T3 XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007148 DR TRANSPATH: XN000007554 DR EMBL: M61011; MMAL1CO (803:831). XX RN [1] RX MEDLINE; 90277689. RA Karsenty G., de Crombrugghe B. RT Two different negative and one positive regulatory factors interact with a RT short promoter segment of the alpha1(I) collagen gene RL J. Biol. Chem. 265:9934-9942 (1990). RN [2] RX MEDLINE; 88290678. RA Maity S. N., Golumbek P. T., Karsenty G., de Crombrugghe B. RT Selective Activation of Transcription by a Novel CCAAT Binding Factor RL Science 241:582-584 (1988). XX // AC R00229 XX ID MOUSE$A21COL_01 XX DT 20.06.1990 (created); ewi. DT 04.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE A2(1) COL (alpha2(I) collagen); Gene: G000474. XX SQ TTGGCAAGGCCGA. XX SF -315 ST -295 XX BF T00535; NF-1; Quality: 6; Species: rat, Rattus norvegicus. BF T00537; NF-1; Quality: 6; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0003; 3T3 SO 0289; rl XX MM DNase I footprinting MM exonuclease III MM gel retardation MM methylation interference XX CC conflict: sequence is ttggcaaggGcga in MMC1A2 XX DR TRANSPATH: XN000007720 DR TRANSPATH: XN000007741 DR EMBL: K01832; MMC1A2 (1043:1055). DR EPD: EP24026; MM_CA21. XX RN [1] RX MEDLINE; 88151045. RA Rossi P., Karsenty G., Roberts A. B., Roche N. S., Sporn M. B., de RA Crombrugghe B. RT A Nuclear Factor I Binding Site Mediates the Transcriptional Activation of RT a Type I Collagen Promoter by Transforming Growth Factor-beta RL Cell 52:405-414 (1988). RN [2] RX MEDLINE; 88330929. RA Karsenty G., Golumbek P., de Crombrugghe B. RT Point Mutations and Small Substitution Mutations in Three Different RT Upstream Elements Inhibit the Activity of the Mouse alpha2(I) Collagen RT Promoter RL J. Biol. Chem. 263:13909-13915 (1988). RN [3] RX MEDLINE; 87280193. RA Oikarinen J., Hatamochi A., de Crombrugghe B. RT Separate Binding Sites for Nuclear Factor 1 and a CCAAT DNA Binding Factor RT in the Mouse alpha2(I) Collagen Promoter RL J. Biol. Chem. 262:11064-11070 (1987). RN [4] RX MEDLINE; 86278237. RA Hatamochi A., Paterson B., de Crombrugghe B. RT Differential binding of a CCAAT DNA binding factor to the promoters of the RT mouse alpha2(I) and alpha1(III) collagen genes RL J. Biol. Chem. 261:11310-11314 (1986). XX // AC R00230 XX ID MOUSE$A21COL_02 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE A2(1) COL (alpha2(I) collagen); Gene: G000474. XX SQ CAGA. XX SF -350 ST -103 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0003; 3T3 XX MM gel retardation XX DR EMBL: K01832; MMC1A2 (1102:1105). DR EPD: EP24026; MM_CA21. XX RN [1] RX MEDLINE; 88330929. RA Karsenty G., Golumbek P., de Crombrugghe B. RT Point Mutations and Small Substitution Mutations in Three Different RT Upstream Elements Inhibit the Activity of the Mouse alpha2(I) Collagen RT Promoter RL J. Biol. Chem. 263:13909-13915 (1988). XX // AC R00231 XX ID MOUSE$A21COL_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE A2(1) COL (alpha2(I) collagen); Gene: G000474. XX SQ ATTGG. XX SF -108 ST 54 XX BF T00092; CCAAT-binding factor; Quality: 6; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0003; 3T3 XX MM gel retardation XX DR TRANSPATH: XN000007160 DR EMBL: K01832; MMC1A2 (1265:1269). DR EPD: EP24026; MM_CA21. XX RN [1] RX MEDLINE; 88330929. RA Karsenty G., Golumbek P., de Crombrugghe B. RT Point Mutations and Small Substitution Mutations in Three Different RT Upstream Elements Inhibit the Activity of the Mouse alpha2(I) Collagen RT Promoter RL J. Biol. Chem. 263:13909-13915 (1988). XX // AC R00232 XX ID MOUSE$A21COL_04 XX DT 20.06.1990 (created); ewi. DT 04.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE A2(1) COL (alpha2(I) collagen); Gene: G000474. XX SQ ATTGG. XX SF -100 ST -73 XX BF T00083; CBF (2); Quality: 6; Species: mouse, Mus musculus. BF T00087; CBF-A; Quality: 6; Species: rat, Rattus norvegicus. BF T00088; CBF-B; Quality: 6; Species: rat, Rattus norvegicus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0003; 3T3 SO 0289; rl SO 0320; rec(rat-ret lys) XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007149 DR TRANSPATH: XN000007159 DR EMBL: K01832; MMC1A2 (1265:1269). DR EPD: EP24026; MM_CA21. XX RN [1] RX MEDLINE; 96371074. RA Hasegawa T., Zhou X., Garrett L. A., Ruteshouser E. C., Maity S. N., de RA Crombrugghe B. RT Evidence for three major transcription activation elements in the proximal RT mouse proalpha2(I) collagen promoter RL Nucleic Acids Res. 24:3253-3260 (1996). RN [2] RX MEDLINE; 91093096. RA Vuorio T., Maity S. N., de Crombrugghe B. RT Purification and molecular cloning of the A chain of a rat heteromeric RT CCAAT-binding protein. Sequence identity with the yeast HAP3 transcription RT factor RL J. Biol. Chem. 265:22480-22486 (1990). RN [3] RX MEDLINE; 90319116. RA Maity S. N., Vuorio T., de Crombrugghe B. RT The B subunit of a rat heteromeric CCAAT-binding transcription factor shows RT a striking sequence identity with the yeast Hap2 transcription factor RL Proc. Natl. Acad. Sci. USA 87:5378-5382 (1990). RN [4] RX MEDLINE; 88290678. RA Maity S. N., Golumbek P. T., Karsenty G., de Crombrugghe B. RT Selective Activation of Transcription by a Novel CCAAT Binding Factor RL Science 241:582-584 (1988). XX // AC R00233 XX ID MOUSE$A21COL_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE A2(1) COL (alpha2(I) collagen); Gene: G000474. XX SQ gcccagccctcccATTGGtggagacg. XX SF -95 ST -70 XX BF T00233; EFI; Quality: 6; Species: chick, Gallus gallus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0003; 3T3 SO 0100; HeLa SO 0260; P388 SO 0289; rl XX MM exonuclease III MM gel retardation XX DR TRANSPATH: XN000007354 DR EMBL: K01832; MMC1A2 (1252:1277). DR EPD: EP24026; MM_CA21. XX RN [1] RX MEDLINE; 91093062. RA Faber M., Sealy L. RT Rous sarcoma virus enhancer factor I is a ubiquitous CCAAT transcription RT factor highly related to CBF and NF-Y RL J. Biol. Chem. 265:22243-22254 (1990). RN [2] RX MEDLINE; 87280193. RA Oikarinen J., Hatamochi A., de Crombrugghe B. RT Separate Binding Sites for Nuclear Factor 1 and a CCAAT DNA Binding Factor RT in the Mouse alpha2(I) Collagen Promoter RL J. Biol. Chem. 262:11064-11070 (1987). RN [3] RX MEDLINE; 86278237. RA Hatamochi A., Paterson B., de Crombrugghe B. RT Differential binding of a CCAAT DNA binding factor to the promoters of the RT mouse alpha2(I) and alpha1(III) collagen genes RL J. Biol. Chem. 261:11310-11314 (1986). XX // AC R00234 XX ID RAT$A12COL_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE A1(2) COL (alpha1(II) collagen); Gene: G000696. XX SQ CCTCTGTGTAGgaaTACACCAGA. SQ ACCCTCTCTT. SQ CACCTCC. XX EL CIIS1 XX SF -700 ST -601 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa XX MM gel retardation XX RN [1] RX MEDLINE; 90216690. RA Savagner P., Miyashita T., Yamada Y. RT Two silencers regulate the tissue-specific expression of the collagen II RT gene RL J. Biol. Chem. 265:6669-6674 (1990). XX // AC R00235 XX ID HS$CLASE_01 XX DT 20.06.1990 (created); ewi. DT 28.02.1995 (updated); dbo. CO Copyright (C), Biobase GmbH. XX TY D XX DE CLG (interstitial collagenase); Gene: G000229. XX SQ ATGAGTCAGA. XX EL TRE; box 2 XX SF -79 ST -60 XX BF T00029; AP-1; Quality: 2; Species: human, Homo sapiens. BF T00123; c-Fos; Quality: 6; Species: human, Homo sapiens. BF T00133; c-Jun; Quality: 6; Species: human, Homo sapiens. BF T01380; CREB; Quality: 6; Species: mink, Mustela vison. BF T01381; deltaCREB; Quality: 6; Species: mink, Mustela vison. BF T00676; pap1; Quality: 6; Species: fission yeast, Schizosaccharomyces pombe. BF T00893; v-Jun; Quality: 6; Species: ASV, avian sarcoma virus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa SO 0101; HeLa+ SO 0104; HepG2 SO 0180; rat-2 SO 0184; S49 SO 0306; rec(human-E.coli) SO 0308; rec(S.pombe-E.coli) SO 0323; rec(human-ret lys) SO 0433; skin fibroblasts + TPA XX MM DNase I footprinting MM methidiumpropyl-EDTA.Fe(II) MM direct gel shift MM supershift (antibody binding) MM methylation protection MM in vivo / genomic methylation protection XX CC enhanced AP-1 activity in BHK cells after HSV-1 infection, in HeLa cells CC after UV irradiation or TPA treatment; RAR-alpha inhibits binding by rec CC c-Jun or AP-1 [7]; T3R-alpha, -beta antagonize binding by AP-1 or c-Jun CC [5]; CREB binding in vitro is largely enhanced after TGF-beta1-induced CC phosphorylation by a kinase different from PKA XX DR TRANSPATH: XN000005737 DR TRANSPATH: XN000005738 DR TRANSPATH: XN000005739 DR TRANSPATH: XN000008808 DR TRANSPATH: XN000008810 DR EMBL: M16567; HSCN2A (455:464). DR EPD: EP15034; HS_COG1. XX RN [1] RX MEDLINE; 92289689. RA Koenig H., Ponta H., Rahmsdorf H. J., Herrlich P. RT Interference between pathway-specific transcription factors: RT glucocorticoids antagonize phorbol ester-induced AP-1 activity without RT altering AP-1 site occupation in vivo RL EMBO J. 11:2241-2246 (1992). RN [2] RX MEDLINE; 91309144. RA Kerppola T. K., Curran T. RT Fos-Jun heterodimers and Jun homodimers bend DNA in opposite orientations: RT implications for transcription factor cooperativity RL Cell 66:317-326 (1991). RN [3] RX MEDLINE; 91216102. RA Kramer I. M., Koornneef I., de Laat S. W., van den Eijnden-van Raaij A. J. RA M. RT TGF-beta1 induces phosphorylation of the cyclic AMP responsive element RT binding protein in ML-CCI64 cells RL EMBO J. 10:1083-1089 (1991). RN [4] RX MEDLINE; 91115099. RA Toda T., Shimanuki M., Yanagida M. RT Fission yeast gene that confer resistance to staurosporine encode an RT AP-1-like transcription factor and a protein kinase related to the RT mammalian ERK1/MAP2 and budding yeast FUS3 and KSS1 kinases RL Genes Dev. 5:60-73 (1991). RN [5] RX MEDLINE; 92049330. RA Zhang X.-K., Wills K. N., Husman M., Hermann T., Pfahl M. RT Novel pathway for thyroid hormone receptor action through interaction with RT jun and fos oncogene activities RL Mol. Cell. Biol. 11:6016-6025 (1991). RN [6] RX MEDLINE; 92020119. RA Jang K. L., Pulverer B., Woodgett J., Latchman D. S. RT Activation of the cellular transcription factor AP-1 in herpes simplex RT virus infected cells is dependent on the viral immediate-early protein ICPO RL Nucleic Acids Res. 19:4879-4883 (1991). RN [7] RX MEDLINE; 91296767. RA Schuele R., Rangarajan P., Yang N., Kliewer S., Ransone L. J., Bolado J., RA Verma I. M., Evans R. M. RT Retinoic acid is a negative regulator of AP-1-responsive genes RL Proc. Natl. Acad. Sci. USA 88:6092-6096 (1991). RN [8] RX MEDLINE; 90235276. RA Kerr L. D., Miller D. B., Matrisian L. M. RT TGF-beta1 inhibition of transin/stromelysin gene expression is mediated RT through a fos binding sequence RL Cell 61:267-278 (1990). RN [9] RX MEDLINE; 90381775. RA Jonat C., Rahmsdorf H. J., Park K.-K., Cato A. C. B., Gebel S., Ponta H., RA Herrlich P. RT Antitumor promotion and antiinflammation: Down-modulation of AP-1 (Fos/Jun) RT activity by glucocorticoid hormone RL Cell 62:1189-1204 (1990). RN [10] RX MEDLINE; 90174947. RA Timmers H. T. M., Pronk G. J., Bos J. L., van der Eb A. J. RT Analysis of the rat JE gene promoter identifies an AP-1 binding site RT essential for basal expression but not for TPA induction RL Nucleic Acids Res. 18:23-34 (1990). RN [11] RX MEDLINE; 90291989. RA Gutman A., Wasylyk B. RT The collagenase gene promoter contains a TPA and oncogene-responsive unit RT encompassing the PEA3 and AP-1 binding sites RL EMBO J. 9:2241-2246 (1990). RN [12] RX MEDLINE; 90152343. RA Mueller U., Roberts M. P., Engel D. A., Doerfler W., Shenk T. RT Induction of transcription factor AP-1 by adenovirus E1A protein and cAMP RL Genes Dev. 3:1991-2002 (1989). RN [13] RX MEDLINE; 90097934. RA Stein B., Rahmsdorf H. J., Steffen A., Litfin M., Herrlich P. RT UV-Induced DNA Damage Is an Intermediate Step in UV-Induced Expression of RT Human Immunodeficiency Virus Type 1 Collagenase, c-fos and Metallothionein RL Mol. Cell. Biol. 9:5169-5181 (1989). RN [14] RX MEDLINE; 89384902. RA Neuberg M., Adamkiewicz J., Hunter J. B., Mueller R. RT A Fos protein containing the leucine zipper forms a homodimer which binds RT to the AP1 binding site RL Nature 341:243-245 (1989). RN [15] RX MEDLINE; 88156935. RA Angel P., Allegretto E. A., Okino S. T., Hattori K., Boyle W. J., Hunter RA T., Karin M. RT Oncogene jun encodes a sequence-specific trans-activator similar to AP-1 RL Nature 332:166-171 (1988). RN [16] RX MEDLINE; 87215937. RA Angel P., Imagawa M., Chiu R., Stein B., Imbra R. J., Rahmsdorf H. J., RA Jonat C., Herrlich P., Karin M. RT Phorbol ester-inducible genes contain a common cis element recognized by a RT TPA-modulated trans-acting factor RL Cell 49:729-739 (1987). XX // AC R00236 XX ID DIDI$CP1_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE CP1 (cysteine protease); Gene: G000085. XX SQ AAAGGAATGGGGGTTC. XX SF -210 ST -195 XX BF T00315; GBF; Quality: 6; Species: slime mould, Dictyostelium discoideum. XX MX M00633; F$GBF_Q6 XX OS slime mould, Dictyostelium discoideum OC Eukaryota; Dictyosteliida; Dictyostelium. XX MM gel retardation MM methylation interference XX RN [1] RX MEDLINE; 90249746. RA Hjorth A. L., Pears C., Williams J. G., Firtel R. A. RT A developmentally regulated trans-acting factor recognizes dissimilar RT G/C-rich elements controlling a class of cAMP-inducible Dictyostelium genes RL Genes Dev. 4:419-432 (1990). XX // AC R00237 XX ID HS$CRP_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CRP (C-reactive protein); Gene: G000233. XX SQ TTTGTAATAAATAACTCA. XX SF -175 ST -133 XX BF T00368; HNF-1A; Quality: 4; Species: human, Homo sapiens. BF T01950; HNF-1B; Quality: 4; Species: human, Homo sapiens. BF T01951; HNF-1C; Quality: 4; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0103; Hep3B XX MM DNase I footprinting MM gel retardation MM gel shift competition XX CC EMBL sequence starts at AATAAATAA: XX DR TRANSPATH: XN000007512 DR TRANSPATH: XN000009103 DR TRANSPATH: XN000009114 XX RN [1] RX MEDLINE; 90151621. RA Majello B., Arcone R., Toniatti C., Ciliberto G. RT Constitutive and IL-6-induced nuclear factors that interact with the human RT C-reactive protein promoter RL EMBO J. 9:457-465 (1990). RN [2] RX MEDLINE; 91092271. RA Toniatti C., Demartis A., Monaci P., Nocosia A., Ciliberto G. RT Synergistic trans-activation of the human C-reactive protein promoter by RT transcription factor HNF-1 binding at two distinct sites RL EMBO J. 9:4467-4475 (1990). XX // AC R00238 XX ID HS$CRP_02 XX DT 20.06.1990 (created); ewi. DT 04.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CRP (C-reactive protein); Gene: G000233. XX SQ CAATGTTGGAAAATTATttacat. XX SF -80 ST -57 XX BF T00017; C/EBPbeta; Quality: 6; Species: mouse, Mus musculus. BF T00368; HNF-1A; Quality: 4; Species: human, Homo sapiens. BF T01950; HNF-1B; Quality: 4; Species: human, Homo sapiens. BF T01951; HNF-1C; Quality: 4; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0103; Hep3B XX MM DNase I footprinting MM gel retardation MM gel shift competition XX DR TRANSPATH: XN000005741 DR TRANSPATH: XN000007512 DR TRANSPATH: XN000009103 DR TRANSPATH: XN000009114 DR EMBL: M11880; HSCRPG (84:106). XX RN [1] RX MEDLINE; 90151621. RA Majello B., Arcone R., Toniatti C., Ciliberto G. RT Constitutive and IL-6-induced nuclear factors that interact with the human RT C-reactive protein promoter RL EMBO J. 9:457-465 (1990). RN [2] RX MEDLINE; 91092271. RA Toniatti C., Demartis A., Monaci P., Nocosia A., Ciliberto G. RT Synergistic trans-activation of the human C-reactive protein promoter by RT transcription factor HNF-1 binding at two distinct sites RL EMBO J. 9:4467-4475 (1990). XX // AC R00239 XX ID HS$CRP_03 XX DT 20.06.1990 (created); ewi. DT 01.12.1998 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CRP (C-reactive protein); Gene: G000233. XX RE promoter XX SQ AGTGGCGCAA. XX SF -55 ST -37 XX BF T00105; C/EBPalpha; Quality: 2; Species: human, Homo sapiens. BF T00581; C/EBPbeta; Quality: 1; Species: human, Homo sapiens. BF T00109; C/EBPdelta; Quality: 1; Species: rat, Rattus norvegicus. XX MX M00621; V$CEBPDELTA_Q6 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0103; Hep3B SO 0301; rec(rat-E.coli) XX MM DNase I footprinting MM functional analysis MM gel retardation MM direct gel shift MM supershift (antibody binding) MM immunoprecipitation XX DR TRANSPATH: XN000005742 DR TRANSPATH: XN000005743 DR EMBL: M11880; HSCRPG (107:116). XX RN [1] RX MEDLINE; 93181204. RA Ramji D. P., Vitelli A., Tronche F., Cortese R., Ciliberto G. RT The two C/EBP isoforms, IL-6DBP/NF-IL6 and C/EBP delta/NF-IL6 beta, are RT induced by IL-6 to promote acute phase gene transcription via different RT mechanisms RL Nucleic Acids Res. 21:289-294 (1993). RN [2] RX MEDLINE; 91029495. RA Poli V., Mancini F. P., Cortese R. RT IL-6DBP, a nuclear protein involved in interleukin-6 signal transduction, RT defines a new family of leucine zipper proteins related to C/EBP RL Cell 63:643-653 (1990). RN [3] RX MEDLINE; 90151621. RA Majello B., Arcone R., Toniatti C., Ciliberto G. RT Constitutive and IL-6-induced nuclear factors that interact with the human RT C-reactive protein promoter RL EMBO J. 9:457-465 (1990). XX // AC R00240 XX ID MOUSE$MCK_01 XX DT 20.06.1990 (created); ewi. DT 15.05.1997 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE mck (muscle-type creatine kinase); Gene: G000557. XX SQ GACATGTGGC. SQ CCAACACCTGCTGC. XX EL MCK-L, MCK-R XX SF -1256 ST -1050 XX BF T00204; E12; Quality: 6; Species: human, Homo sapiens. BF T00506; MEF1; Quality: 6; Species: mouse, Mus musculus. BF T00526; MyoD; Quality: 6; Species: mouse, Mus musculus. BF T00926; SUM-1; Quality: 6; Species: sea urchin, Lytechinus variegatus. BF T00814; TFE3-S; Quality: 4; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0042; C2 myoblasts SO 0157; MM14 SO 0303; rec(mouse-E.coli) SO 0322; rec(Lytechinus variegatus-ret lys) SO 0326; rec(mouse-ret lys) XX MM DNase I footprinting MM gel retardation MM gel shift competition MM methylation protection MM methylation interference XX DR TRANSPATH: XN000007307 DR TRANSPATH: XN000007667 DR TRANSPATH: XN000007691 DR TRANSPATH: XN000008130 DR TRANSPATH: XN000008348 DR EMBL: M21390; MMMCKA (178:187). DR EMBL: M21390; MMMCKA (200:213). XX RN [1] RX MEDLINE; 95403385. RA Apone S., Hauschka S. D. RT Muscle gene E-box control elements RL J. Biol. Chem. 270:21420-21427 (1995). RN [2] RX MEDLINE; 92123207. RA Roman C., Matera A. G., Cooper C., Artandi S., Blain S., Ward D. C., Calame RA K. RT mTFE3, an X-linked transcriptional activator containing basic RT helix-loop-helix and zipper domains, utilizes the zipper to stabilize both RT DNA binding and multimerization RL Mol. Cell. Biol. 12:817-827 (1992). RN [3] RX MEDLINE; 91296792. RA Venuti J. M., Goldberg L., Chakraborty T., Olson E. N., Klein W. H. RT A myogenic factor from sea urchin embryos capable of programming muscle RT differentiation in mammalian cells RL Proc. Natl. Acad. Sci. USA 88:6219-6223 (1991). RN [4] RX MEDLINE; 90182663. RA Davis R. L., Cheng P.-F., Lassar A. B., Weintraub H. RT The MyoD DNA binding domain contains a recognition code for muscle-specific RT gene activation RL Cell 60:733-746 (1990). RN [5] RX MEDLINE; 90332633. RA Weintraub H., Davis R., Lockshon D., Lassar A. RT MyoD binds cooperatively to two sites in a target enhancer sequence: RT Occupancy of two sites is required for activation RL Proc. Natl. Acad. Sci. USA 87:5623-5627 (1990). RN [6] RX MEDLINE; 89376533. RA Lassar A. B., Buskin J. B., Lockshon D., Davis R. L., Apone S., Hauschka S. RA D., Weintraub H. RT MyoD is a sequence-specific DNA-binding protein requiring a region of myc RT homology to bind to the muscle creatine kinase enhancer RL Cell 58:823-831 (1989). RN [7] RX MEDLINE; 89336785. RA Murre C., McCaw P. S., Vaessin H., Caudy M., Jan L. Y., Jan Y. N., Cabrera RA C. V., Buskin J. N., Hauschka S. D., Lassar A. B., Weintraub H., Baltimore RA D. RT Interactions between heterologous helix-loop-helix proteins generate RT complexes that bind specifically to a common DNA sequence RL Cell 58:537-544 (1989). RN [8] RX MEDLINE; 89343980. RA Buskin J. N., Hauschka S. D. RT Identification of a Myocyte Nuclear Factor That Binds to the RT Muscle-Specific Enhancer of the Mouse Muscle Creatine Kinase Gene RL Mol. Cell. Biol. 9:2627-2640 (1989). XX // AC R00241 XX ID MOUSE$MCK_02 XX DT 20.06.1990 (created); ewi. DT 20.04.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE mck (muscle-type creatine kinase); Gene: G000557. XX SQ CCAACACCTGCTGCctga. XX SF -1256 ST -1050 XX BF T00204; E12; Quality: 6; Species: human, Homo sapiens. BF T00207; E47; Quality: 6; Species: human, Homo sapiens. BF T00507; MF3; Quality: 6; Species: chick, Gallus gallus. BF T00526; MyoD; Quality: 6; Species: mouse, Mus musculus. XX MX M00693; V$E12_Q6 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0042; C2 myoblasts SO 0157; MM14 SO 0326; rec(mouse-ret lys) SO 0372; skeletal muscle XX MM gel retardation MM ethylation protection XX DR TRANSPATH: XN000007307 DR TRANSPATH: XN000007311 DR TRANSPATH: XN000007669 DR TRANSPATH: XN000007691 DR EMBL: M21390; MMMCKA (200:217). XX RN [1] RX MEDLINE; 91172180. RA Santoro I. M., Yi T.-M., Walsh K. RT Identification of single-stranded-DNA-binding proteins that interact with RT muscle gene elements RL Mol. Cell. Biol. 11:1944-1953 (1991). RN [2] RX MEDLINE; 90199896. RA Benezra R., Davis R. L., Lockshon D., Turner D. L., Weintraub H. RT The protein Id: a negative regulator of helix-loop-helix DNA binding RT proteins RL Cell 61:49-59 (1990). XX // AC R00242 XX ID MOUSE$MCK_03 XX DT 20.06.1990 (created); ewi. DT 13.11.1997 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE mck (muscle-type creatine kinase); Gene: G000557. XX SQ cccaaCACCTGCtgcctgagcc. XX EL MCK-R XX SF -1156 ST -1135 XX BF T01621; ASH-1; Quality: 6; Species: clawed frog, Xenopus laevis. BF T01622; ASH-3a; Quality: 6; Species: clawed frog, Xenopus laevis. BF T01623; ASH-3b; Quality: 6; Species: clawed frog, Xenopus laevis. BF T00204; E12; Quality: 2; Species: human, Homo sapiens. BF T00207; E47; Quality: 2; Species: human, Homo sapiens. BF T01503; HEB; Quality: 2; Species: human, Homo sapiens. BF T00433; ITF-2; Quality: 2; Species: human, Homo sapiens. BF T00484; MASH-1; Quality: 6; Species: rat, Rattus norvegicus. BF T01619; MASH-1; Quality: 6; Species: mouse, Mus musculus. BF T01620; MASH-1; Quality: 6; Species: human, Homo sapiens. BF T00485; MASH-2; Quality: 6; Species: rat, Rattus norvegicus. BF T00506; MEF1; Quality: 6; Species: mouse, Mus musculus. BF T00512; MRF4; Quality: 2; Species: rat, Rattus norvegicus. BF T00526; MyoD; Quality: 2; Species: mouse, Mus musculus. BF T01128; MyoD; Quality: 2; Species: chick, Gallus gallus. BF T00528; myogenin; Quality: 2; Species: mouse, Mus musculus. XX MX M00698; V$HEB_Q6 MX M00712; V$MYOGENIN_Q6 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0042; C2 myoblasts SO 0303; rec(mouse-E.coli) SO 0320; rec(rat-ret lys) SO 0323; rec(human-ret lys) SO 0326; rec(mouse-ret lys) SO 0344; rec(human-COS) SO 0345; rec(mouse-COS) SO 0402; BC3H1 SO 0442; rec(chick-baculovirus-Sf9) SO 0876; rec(chick-wheat germ) XX MM gel retardation MM direct gel shift MM supershift (antibody binding) MM methylation interference XX CC BC3H1: differentiated cells only; antibodies against E47 and MyoD XX DR TRANSPATH: XN000007307 DR TRANSPATH: XN000007311 DR TRANSPATH: XN000007572 DR TRANSPATH: XN000007638 DR TRANSPATH: XN000007639 DR TRANSPATH: XN000007667 DR TRANSPATH: XN000007671 DR TRANSPATH: XN000007691 DR TRANSPATH: XN000007701 DR TRANSPATH: XN000008558 DR TRANSPATH: XN000008889 DR TRANSPATH: XN000008945 DR TRANSPATH: XN000008946 DR TRANSPATH: XN000008947 DR TRANSPATH: XN000008948 DR TRANSPATH: XN000008949 DR EMBL: M21390; MMMCKA (199:220). XX RN [1] RX MEDLINE; 94043282. RA Mitsui K., Shirakata M., Paterson B. M. RT Phosphorylation inhibits the DNA-binding activity of MyoD homodimers but RT not MyoD-E12 heterodimers RL J. Biol. Chem. 268:24415-24420 (1993). RN [2] RX MEDLINE; 92228833. RA Johnson J. E., Birren S. J., Saito T., Anderson D. J. RT DNA binding and transcriptional regulatory activity of mammalian RT achaete-scute homologous (MASH) proteins revealed by interaction with a RT muscle-specific enhancer RL Proc. Natl. Acad. Sci. USA 89:3596-3600 (1992). RN [3] RX MEDLINE; 92188160. RA Anthony-Cahill S. J., Benfield P. A., Fairman R., Wasserman Z. R., Brenner RA S. L., Stafford III W. F., Altenbach C., Hubbell W. L., DeGrado W. F. RT Molecular characterization of helix-loop-helix peptides RL Science 255:979-983 (1992). RN [4] RX MEDLINE; 93024452. RA Shaknovich R., Shue G., Kohtz D. S. RT Conformational activation of a basic helix-loop-helix protein (MyoD1) by RT the C-terminal region of murine HSP90 (HSP84) RL Mol. Cell. Biol. 12:5059-5068 (1992). RN [5] RX MEDLINE; 93024459. RA Johnston L. A., Tapscott S. J., Eisen H. RT Sodium butyrate inhibits myogenesis by interfering with the transcriptional RT activation function of MyoD and myogenin RL Mol. Cell. Biol. 12:5123-5130 (1992). RN [6] RX MEDLINE; 92186835. RA Hu J.-S., Olson E. N., Kingston R. E. RT HEB, a helix-loop-helix protein related to E2A and ITF2 that can modulate RT the DNA-binding ability of myogenic regulatory factors RL Mol. Cell. Biol. 12:1031-1042 (1992). RN [7] RX MEDLINE; 91309143. RA Lassar A. B., Davis R. L., Wright W. E., Kadesch T., Murre C., Voronova A., RA Baltimore D., Weintraub H. RT Functional activity of myogenic HLH proteins requires RT hetero-oligomerization with E12/E47-like proteins in vivo RL Cell 66:305-315 (1991). RN [8] RX MEDLINE; 91131581. RA Chakraborty T., Brennan T., Olson E. RT Differential trans-activation of a muscle-specific enhancer by myogenic RT helix-loop-helix proteins is separable from DNA binding RL J. Biol. Chem. 266:2878-2882 (1991). RN [9] RX MEDLINE; 91117219. RA Murre C., Voronova A., Baltimore D. RT B-cell- and myocyte-specific E2-box-binding factors contain E12/E47-like RT subunits RL Mol. Cell. Biol. 11:1156-1160 (1991). RN [10] RX MEDLINE; 91260712. RA Chakraborty T., Brennan T. J., Li L., Edmondson D., Olson E. N. RT Inefficient homooligomerization contributes to the dependence of myogenin RT on E2A products for efficient DNA binding RL Mol. Cell. Biol. 11:3633-3641 (1991). RN [11] RX MEDLINE; 91288527. RA Brennan T. J., Chakraborty T., Olson E. N. RT Mutagenesis of the myogenin basic region identifies an ancient protein RT motif critical for activation of myogenesis RL Proc. Natl. Acad. Sci. USA 88:5675-5679 (1991). RN [12] RX MEDLINE; 90299130. RA Brennan T. J., Olson E. N. RT Myogenin resides in the nucleus and acquires high affinity for a conserved RT enhancer element on heterodimerization RL Genes Dev. 4:582-595 (1990). XX // AC R00243 XX ID MOUSE$MCK_04 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE mck (muscle-type creatine kinase); Gene: G000557. XX SF -1094 ST -1048 XX BF T00491; MBF-1; Quality: 6; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0042; C2 myoblasts XX MM gel retardation XX DR TRANSPATH: XN000007655 XX RN [1] RX MEDLINE; 90097919. RA Gossett L. A., Kelvin D. J., Sternberg E. A., Olson E. N. RT A new myocyte-specific enhancer-binding factor that recognizes a conserved RT element associated with multiple muscle-specific genes RL Mol. Cell. Biol. 9:5022-5033 (1989). XX // AC R00244 XX ID MOUSE$MCK_05 XX DT 20.06.1990 (created); ewi. DT 13.10.2000 (updated); dkl. CO Copyright (C), Biobase GmbH. XX TY D XX DE mck (muscle-type creatine kinase); Gene: G000557. XX SQ ggaggagaagctcgctCTAAAAATAAccct. XX EL MEF-2 XX SF -1091 ST -1062 XX BF T01006; aMEF-2; Quality: 6; Species: human, Homo sapiens. BF T00505; MEF-2; Quality: 1; Species: mouse, Mus musculus. BF T01004; MEF-2; Quality: 6; Species: rat, Rattus norvegicus. BF T01005; MEF-2; Quality: 6; Species: human, Homo sapiens. BF T01784; MEF-2 (516 AA); Quality: 1; Species: clawed frog, Xenopus laevis. XX MX M00403; V$AMEF2_Q6 MX M00405; V$MMEF2_Q6 MX M00406; V$HMEF2_Q6 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0042; C2 myoblasts SO 0043; C2C12 SO 0323; rec(human-ret lys) SO 0368; neonatal cardiocytes (rat) SO 0400; 10TFL2-3 SO 0401; CV8-1 SO 0402; BC3H1 SO 0403; C025 SO 0483; C3H 10T-1/2 + aza SO 0516; Sol8 SO 0517; pulmonary artery smooth muscle SO 0518; 3T3+MyoD SO 0638; L6E9 SO 0666; Schneider XX MM DNase I footprinting MM direct gel shift MM supershift (antibody binding) MM methylation protection XX CC the bound complex contains neither MyoD nor myogenin nor E12/E47; also CC binds paired-like homeodomain protein MHox and POU domain protein Oct-1 XX DR TRANSPATH: XN000005744 DR TRANSPATH: XN000005745 DR TRANSPATH: XN000008414 DR TRANSPATH: XN000008421 DR TRANSPATH: XN000009010 DR EMBL: M21390; MMMCKA (264:293). XX RN [1] RX MEDLINE; 96394665. RA Ornatsky O.I., McDermott J.C. RT MEF2 protein expression, DNA binding specificity and complex composition, RT and transcriptional activity in muscle and non-muscle cells RL J. Biol. Chem. 271:24927-24933 (1996). RN [2] RX MEDLINE; 96069901. RA Olson E.N., Perry M., Schulz R.A. RT Regulation of muscle differentiation by the MEF2 family of MADS box RT transcription factors RL Dev. Biol. 172:2-14 (1995). RN [3] RX MEDLINE; 92387551. RA Yu Y.-T., Breitbart R. E., Smoot L. B., Lee Y., Mahdavi V., Nadal-Ginard B. RT Human myocyte-specific enhancer factor 2 comprises a group of RT tissue-restricted MADS box transcription factors RL Genes Dev. 6:1783-1798 (1992). RN [4] RX MEDLINE; 91309143. RA Lassar A. B., Davis R. L., Wright W. E., Kadesch T., Murre C., Voronova A., RA Baltimore D., Weintraub H. RT Functional activity of myogenic HLH proteins requires RT hetero-oligomerization with E12/E47-like proteins in vivo RL Cell 66:305-315 (1991). RN [5] RX MEDLINE; 92017759. RA Cserjesi P., Olson E. N. RT Myogenin induces the myocyte-specific enhancer binding factor MEF-2 RT independently of other muscle-specific gene products RL Mol. Cell. Biol. 11:4854-4862 (1991). RN [6] RX MEDLINE; 90097919. RA Gossett L. A., Kelvin D. J., Sternberg E. A., Olson E. N. RT A new myocyte-specific enhancer-binding factor that recognizes a conserved RT element associated with multiple muscle-specific genes RL Mol. Cell. Biol. 9:5022-5033 (1989). XX // AC R00245 XX ID MOUSE$MCK_06 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE mck (muscle-type creatine kinase); Gene: G000557. XX RE 1st intron XX BF T00506; MEF1; Quality: 6; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0042; C2 myoblasts XX MM direct gel shift XX DR TRANSPATH: XN000007667 XX RN [1] RX MEDLINE; 89343980. RA Buskin J. N., Hauschka S. D. RT Identification of a Myocyte Nuclear Factor That Binds to the RT Muscle-Specific Enhancer of the Mouse Muscle Creatine Kinase Gene RL Mol. Cell. Biol. 9:2627-2640 (1989). XX // AC R00246 XX ID RAT$MCK_01 XX DT 20.06.1990 (created); ewi. DT 20.04.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE mck (muscle-type creatine kinase); Gene: G000766. XX SQ CCTGGACACGTGGTTGC. XX EL E1 site XX SF -1160 ST -1140 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0042; C2 myoblasts XX MM DNase I footprinting MM gel retardation XX DR EMBL: M27092; RNCKMUSCL (357:373). XX RN [1] RX MEDLINE; 89343958. RA Horlick R. A., Benfield P. A. RT The upstream muscle-specific enhancer of the rat muscle creatine kinase RT gene is composed of multiple elements RL Mol. Cell. Biol. 9:2396-2413 (1989). XX // AC R00247 XX ID RAT$MCK_02 XX DT 20.06.1990 (created); ewi. DT 20.04.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE mck (muscle-type creatine kinase); Gene: G000766. XX SQ CCCCACCCCCACC. XX EL E2 site XX SF -1113 ST -1100 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0042; C2 myoblasts XX MM DNase I footprinting MM gel retardation XX DR EMBL: M27092; RNCKMUSCL (401:413). XX RN [1] RX MEDLINE; 89343958. RA Horlick R. A., Benfield P. A. RT The upstream muscle-specific enhancer of the rat muscle creatine kinase RT gene is composed of multiple elements RL Mol. Cell. Biol. 9:2396-2413 (1989). XX // AC R00248 XX ID RAT$MCK_03 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE mck (muscle-type creatine kinase); Gene: G000766. XX SQ CTTGCTCTAAAAATAACTC. XX EL E3 site XX SF -1061 ST -1043 XX BF T01009; RSRFC4; Quality: 6; Species: human, Homo sapiens. XX MX M00407; V$RSRFC4_Q2 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0042; C2 myoblasts SO 0323; rec(human-ret lys) XX MM DNase I footprinting MM direct gel shift MM DEPC interference XX DR TRANSPATH: XN000008426 DR EMBL: M27092; RNCKMUSCL (452:470). XX RN [1] RX MEDLINE; 92084105. RA Pollock R., Treisman R. RT Human SRF-related proteins: DNA-binding properties and potential regulatory RT targets RL Genes Dev. 5:2327-2341 (1991). RN [2] RX MEDLINE; 89343958. RA Horlick R. A., Benfield P. A. RT The upstream muscle-specific enhancer of the rat muscle creatine kinase RT gene is composed of multiple elements RL Mol. Cell. Biol. 9:2396-2413 (1989). XX // AC R00249 XX ID MOUSE$AACR_01 XX DT 20.06.1990 (created); ewi. DT 12.02.1998 (updated); ili. CO Copyright (C), Biobase GmbH. XX TY D XX DE CRY-alphaA (alphaA-crystallin); Gene: G000475. XX SQ GGTGCAGCCTCTCC. XX SF -103 ST -90 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa XX MM gel retardation MM methylation interference XX DR EMBL: J00375; MMCRYAAA (265:278). XX RN [1] RX MEDLINE; 89008476. RA Sommer B., Chepelinsky A. B., Piatigorsky J. RT Binding of Nuclear Proteins to Promoter Elements of the Mouse RT alphaA-crystallin Gene RL J. Biol. Chem. 263:15666-15672 (1988). XX // AC R00250 XX ID MOUSE$AACR_02 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE CRY-alphaA (alphaA-crystallin); Gene: G000475. XX SQ GCCTCTC. XX SF -97 ST -91 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa XX MM gel retardation MM methylation interference XX DR EMBL: J00375; MMCRYAAA (271:277). XX RN [1] RX MEDLINE; 89008476. RA Sommer B., Chepelinsky A. B., Piatigorsky J. RT Binding of Nuclear Proteins to Promoter Elements of the Mouse RT alphaA-crystallin Gene RL J. Biol. Chem. 263:15666-15672 (1988). XX // AC R00251 XX ID MOUSE$AACR_03 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE CRY-alphaA (alphaA-crystallin); Gene: G000475. XX SQ GCATAGAC. XX SF -79 ST -72 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa XX MM gel retardation MM methylation interference XX DR EMBL: J00375; MMCRYAAA (289:296). XX RN [1] RX MEDLINE; 89008476. RA Sommer B., Chepelinsky A. B., Piatigorsky J. RT Binding of Nuclear Proteins to Promoter Elements of the Mouse RT alphaA-crystallin Gene RL J. Biol. Chem. 263:15666-15672 (1988). XX // AC R00252 XX ID CHICK$D1CR_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CRY-delta1 (delta1-crystallin); Gene: G000058. XX SF -120 ST 23 XX BF T00755; Sp1; Quality: 1; Species: chick, Gallus gallus. XX OS chick, Gallus gallus OC eukaryota; animalia; metazoa; chordata; vertebrata; aves; neornithes; OC neognathae; galliformes; phasianidae XX SO 0390; embryonic lenses + IGF-I XX MM gel retardation XX DR TRANSPATH: XN000008071 XX RN [1] RX MEDLINE; 90239012. RA Alemany J., Borras T., de Pablo F. RT Transcriptional stimulation of the sigma1-crystallin gene by insulin-like RT growth factor I and insulin requires DNA cis elements in chicken RL Proc. Natl. Acad. Sci. USA 87:3353-3357 (1990). XX // AC R00253 XX ID Y$CTT1_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CTT1 (catalase T); Gene: G000901. XX SQ AGAACCTCCGTTATCTCCATTCC. XX SF -471 ST -449 XX BF T00346; HAP1; Quality: 4; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR EMBL: X04625; SCCTT1 (153:175). XX RN [1] RX MEDLINE; 89005071. RA Winkler H., Adam G., Mattes E., Schanz M., Hartig A., Ruis H. RT Co-ordinate control of synthesis of mitochondrial and non-mitochondrial RT hemoproteins: a binding site for the HAP1 (CYP1) protein in the UAS region RT of the yeast catalase T gene (CTT1) RL EMBO J. 7:1799-1804 (1988). XX // AC R00254 XX ID Y$CYC1_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CYC1 (mitochondrial iso-1-cytochrome C); Gene: G000904. XX SQ TCCGTGTGAGACGACATC. SQ ATCATATTCGACG. XX S1 ATG SF -680 ST -382 XX BF T00778; TAF; Quality: 2; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM gel retardation XX RN [1] RX MEDLINE; 90251453. RA Dorsman J. C., van Heeswijk W. C., Grivell L. A. RT Yeast general transcription factor GFI: sequence requirements for binding RT to DNA and evolutionary conservation RL Nucleic Acids Res. 18:2769-2776 (1990). XX // AC R00255 XX ID Y$CYC1_02 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CYC1 (mitochondrial iso-1-cytochrome C); Gene: G000904. XX SQ TCCGTGTGAGACGACATC. XX S1 ATG SF -463 ST -446 XX BF T00778; TAF; Quality: 4; Species: yeast, Saccharomyces cerevisiae. XX MX M00703; F$TAF_Q6 XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM gel retardation XX RN [1] RX MEDLINE; 88319925. RA Dorsman J. C., van Heeswijk W. C., Grivell L. A. RT Identification of two factors which bind to the upstream sequences of a RT number of nuclear genes coding for mitochondrial proteins and to genetic RT elements important for cell division in yeast RL Nucleic Acids Res. 16:7287-7301 (1988). XX // AC R00256 XX ID Y$CYC1_03 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CYC1 (mitochondrial iso-1-cytochrome C); Gene: G000904. XX SQ CCGA. XX EL UAS 1, A XX SF -293 ST -278 XX BF T00714; RAF; Quality: 4; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR EMBL: X03472; SCCYC1G5 (28:31). XX RN [1] RX MEDLINE; 87159552. RA Pfeifer K., Arcangioli B., Guarente L. RT Yeast HAP1 activator competes with the factor RC2 for binding to the RT upstream activation site UAS1 of the CYC1 gene RL Cell 49:9-18 (1987). XX // AC R00257 XX ID Y$CYC1_04 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CYC1 (mitochondrial iso-1-cytochrome C); Gene: G000904. XX SQ TGGCCGGGGTTTACGGACGATGA. XX EL UAS 1, B XX SF -269 ST -247 XX BF T00346; HAP1; Quality: 1; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM direct gel shift MM gel shift competition MM methylation interference XX DR EMBL: X03472; SCCYC1G5 (47:69). XX RN [1] RX MEDLINE; 91260726. RA Lodi T., Guiard B. RT Complex transcriptional regulation of the Saccharomyces cerevisiae CYB2 RT gene encoding cytochrome b2: CYP1(HAP1) activator binds to the CYB2 RT upstream activation site UAS1-B2 RL Mol. Cell. Biol. 11:3762-3772 (1991). RN [2] RX MEDLINE; 90280408. RA Kim K. S., Pfeifer K., Powell L., Guarente L. RT Internal deletions in the yeast transcriptional activator HAP1 have RT opposite effects at two sequence elements RL Proc. Natl. Acad. Sci. USA 87:4524-4528 (1990). RN [3] RX MEDLINE; 87159552. RA Pfeifer K., Arcangioli B., Guarente L. RT Yeast HAP1 activator competes with the factor RC2 for binding to the RT upstream activation site UAS1 of the CYC1 gene RL Cell 49:9-18 (1987). XX // AC R00258 XX ID Y$CYC1_05 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CYC1 (mitochondrial iso-1-cytochrome C); Gene: G000904. XX SQ GGCCGGGGTTTAC. XX EL UAS 1, B XX SF -268 ST -256 XX BF T00724; RC2; Quality: 4; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR EMBL: X03472; SCCYC1G5 (48:60). XX RN [1] RX MEDLINE; 89356655. RA Sousa R., Arcangioli B. RT A point mutation in the CYC1 UAS1 creates a new combination of regulatory RT elements that activate transcription synergistically RL EMBO J. 8:1801-1808 (1989). RN [2] RX MEDLINE; 87159552. RA Pfeifer K., Arcangioli B., Guarente L. RT Yeast HAP1 activator competes with the factor RC2 for binding to the RT upstream activation site UAS1 of the CYC1 gene RL Cell 49:9-18 (1987). XX // AC R00259 XX ID Y$CYC1_06 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CYC1 (mitochondrial iso-1-cytochrome C); Gene: G000904. XX SQ GCCGGGGTTTA. XX EL UAS 1, B XX SF -267 ST -251 XX BF T00723; RC1; Quality: 4; Species: yeast, Saccharomyces cerevisiae. BF T00724; RC2; Quality: 4; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM gel retardation XX DR EMBL: X03472; SCCYC1G5 (49:59). XX RN [1] RX MEDLINE; 86030243. RA Arcangioli B., Lescure B. RT Identification of proteins involved in the regulation of yeast RT iso-1-cytochrome C expression by oxygen RL EMBO J. 4:2627-2633 (1985). XX // AC R00260 XX ID Y$CYC1_07 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CYC1 (mitochondrial iso-1-cytochrome C); Gene: G000904. XX SQ GATGACC. XX EL UAS 1, B XX SF -251 ST -245 XX BF T00724; RC2; Quality: 4; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR EMBL: X03472; SCCYC1G5 (65:71). XX RN [1] RX MEDLINE; 87159552. RA Pfeifer K., Arcangioli B., Guarente L. RT Yeast HAP1 activator competes with the factor RC2 for binding to the RT upstream activation site UAS1 of the CYC1 gene RL Cell 49:9-18 (1987). XX // AC R00261 XX ID Y$CYC1_08 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CYC1 (mitochondrial iso-1-cytochrome C); Gene: G000904. XX SQ TGACCGA. XX EL UAS 1, B XX SF -249 ST -243 XX BF T00723; RC1; Quality: 4; Species: yeast, Saccharomyces cerevisiae. BF T00724; RC2; Quality: 4; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM gel retardation XX DR EMBL: X03472; SCCYC1G5 (67:73). XX RN [1] RX MEDLINE; 86030243. RA Arcangioli B., Lescure B. RT Identification of proteins involved in the regulation of yeast RT iso-1-cytochrome C expression by oxygen RL EMBO J. 4:2627-2633 (1985). XX // AC R00262 XX ID Y$CYC1_09 XX DT 20.06.1990 (created); ewi. DT 04.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CYC1 (mitochondrial iso-1-cytochrome C); Gene: G000904. XX SQ ctcatttggcgagcGTTGGt. XX EL UAS2 XX SF -210 ST -204 XX BF T00348; hap2; Quality: 2; Species: fission yeast, Schizosaccharomyces pombe. BF T00349; HAP2; Quality: 2; Species: yeast, Saccharomyces cerevisiae. BF T00350; HAP3; Quality: 2; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast SO 0324; rec(yeast-ret lys) SO 0349; rec(yeast-yeast) SO 0601; S.pombe XX MM direct gel shift MM methylation interference XX DR EMBL: X03472; SCCYC1G5 (88:107). XX RN [1] RX MEDLINE; 94038948. RA Xing Y., Fikes J. D., Guarente L. RT Mutations in yeast HAP2/HAP3 define a hybrid CCAAT box binding domain RL EMBO J. 12:4647-4655 (1993). RN [2] RX MEDLINE; 91117227. RA Olesen J. T., Fikes J. D., Guarente L. RT The Schizosaccharomyces pombe homolog of Saccharomyces cerevisiae HAP2 RT reveals selective and stringent conservation of the small essential core RT protein domain RL Mol. Cell. Biol. 11:611-619 (1991). RN [3] RX MEDLINE; 91065518. RA Olesen J. T., Guarente L. RT The HAP2 subunit of yeast CCAAT transcriptional activator contains adjacent RT domains for subunit association and DNA recognition: model for the HAP2/3/4 RT complex RL Genes Dev. 4:1714-1729 (1990). RN [4] RX MEDLINE; 88165053. RA Chodosh L. A., Olesen J., Hahn S., Baldwin jr A. S., Guarente L., Sharp P. RA A. RT A Yeast and a Human CCAAT-Binding Protein Have Heterologous Subunits That RT Are Functionally Interchangeable RL Cell 53:25-35 (1988). RN [5] RX MEDLINE; 88178109. RA Hahn S., Guarente L. RT Yeast HAP2 and HAP3: transcriptional activators in a heteromeric complex RL Science 240:314-321 (1988). RN [6] RX MEDLINE; 88080482. RA Olesen J., Hahn S., Guarente L. RT Yeast HAP2 and HAP3 Activators Both Bind to the CYC1 Upstream Activation RT Site, UAS2, in an Interdependent Manner RL Cell 51:953-961 (1987). XX // AC R00263 XX ID Y$CYC1_10 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CYC1 (mitochondrial iso-1-cytochrome C); Gene: G000904. XX SQ ctcatttggcgagcGTTGGt. XX EL UAS2 XX SF -210 ST -204 XX BF T00154; CP1A; Quality: 2; Species: human, Homo sapiens. BF T00349; HAP2; Quality: 2; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM gel retardation MM methylation interference XX DR EMBL: X03472; SCCYC1G5 (88:107). XX RN [1] RX MEDLINE; 88165053. RA Chodosh L. A., Olesen J., Hahn S., Baldwin jr A. S., Guarente L., Sharp P. RA A. RT A Yeast and a Human CCAAT-Binding Protein Have Heterologous Subunits That RT Are Functionally Interchangeable RL Cell 53:25-35 (1988). XX // AC R00264 XX ID Y$CYC1_11 XX DT 20.06.1990 (created); ewi. DT 26.02.2001 (updated); rio. CO Copyright (C), Biobase GmbH. XX TY D XX DE CYC1 (mitochondrial iso-1-cytochrome C); Gene: G000904. XX SQ ctcatttggcgagcGTTGGt. XX EL UAS2 XX SF -210 ST -204 XX BF T00350; HAP3; Quality: 2; Species: yeast, Saccharomyces cerevisiae. BF T01804; NF-YA; Quality: 2; Species: human, Homo sapiens. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM gel retardation MM methylation interference XX DR TRANSPATH: XN000009028 DR EMBL: X03472; SCCYC1G5 (88:107). XX RN [1] RX MEDLINE; 88165053. RA Chodosh L. A., Olesen J., Hahn S., Baldwin jr A. S., Guarente L., Sharp P. RA A. RT A Yeast and a Human CCAAT-Binding Protein Have Heterologous Subunits That RT Are Functionally Interchangeable RL Cell 53:25-35 (1988). XX // AC R00265 XX ID Y$CYC7_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE CYC7 (iso-2-cytochrome C); Gene: G000905. XX SQ GCTAATAGCGATAATAGCGAGGG. XX SF -251 ST -229 XX BF T00346; HAP1; Quality: 1; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM direct gel shift MM gel shift competition MM methylation interference XX DR EMBL: J01320; SCCYC7A (138:160). XX RN [1] RX MEDLINE; 91260726. RA Lodi T., Guiard B. RT Complex transcriptional regulation of the Saccharomyces cerevisiae CYB2 RT gene encoding cytochrome b2: CYP1(HAP1) activator binds to the CYB2 RT upstream activation site UAS1-B2 RL Mol. Cell. Biol. 11:3762-3772 (1991). RN [2] RX MEDLINE; 90280408. RA Kim K. S., Pfeifer K., Powell L., Guarente L. RT Internal deletions in the yeast transcriptional activator HAP1 have RT opposite effects at two sequence elements RL Proc. Natl. Acad. Sci. USA 87:4524-4528 (1990). RN [3] RX MEDLINE; 87159543. RA Pfeifer K., Prezant T., Guarente L. RT Yeast HAP1 Activator Binds to Two Upstream Activation Sites of Different RT Sequence RL Cell 49:19-27 (1987). XX // AC R00266 XX ID Y$CYC7_02 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE CYC7 (iso-2-cytochrome C); Gene: G000905. XX SF -201 ST -165 XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM gel retardation XX RN [1] RX MEDLINE; 88038880. RA Prezant T., Pfeifer K., Guarente L. RT Organization of the Regulatory Region of the Yeast CYC7 Gene: Multiple RT Factors Are Involved in Regulation RL Mol. Cell. Biol. 7:3252-3259 (1987). XX // AC R00267 XX ID RAT$CYTOP_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE P-450c (cytochrome P-450c, P450 IA1); Gene: G000734. XX SF -1684 ST -1614 XX BF T00018; AhR; Quality: 6; Species: mouse, Mus musculus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0105; HePa1c1c7 XX MM gel retardation XX CC factor binding induced by TCDD XX DR TRANSPATH: XN000007014 XX RN [1] RX MEDLINE; 88190105. RA Denison M. S., Fisher J. M., Whitlock jr J. P. RT Inducible, receptor-dependent protein-DNA interactions at a RT dioxin-responsive transcriptional activator RL Proc. Natl. Acad. Sci. USA 85:2528-2532 (1988). XX // AC R00268 XX ID RAT$CYTOP_02 XX DT 20.06.1990 (created); ewi. DT 04.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE P-450c (cytochrome P-450c, P450 IA1); Gene: G000734. XX SQ CTAGCGTGACA. XX EL XRE2 XX SF -1092 ST -1069 XX BF T00018; AhR; Quality: 6; Species: mouse, Mus musculus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0107; HePac4 XX MM gel retardation XX CC dioxin receptor binding is dioxin-inducible, binding of the constitutive CC factor (2.8S, 53 kDa) is unaffected by xenobiotics XX DR TRANSPATH: XN000007014 DR EMBL: M14633; RNCP45OC (3180:3190). XX RN [1] RX MEDLINE; 91342630. RA Hapgood J., Cuthill S., Soederkvist P., Wilhelmsson A., Pongratz I., Tukey RA R. H., Johnson E. F., Gustafsson J.-A., Poellinger L. RT Liver cells contain constitutive DNase I-hypersensitive sites at the RT xenobiotic response elements 1 and 2 (XRE1 and -2) of the rat cytochrome RT P-450IA1 gene and a constitutive, nuclear XRE-binding factor that is RT distinct from the dioxin receptor RL Mol. Cell. Biol. 11:4314-4323 (1991). RN [2] RX MEDLINE; 89098930. RA Hapgood J., Cuthill S., Denis M., Poellinger L., Gustafsson J.-A. RT Specific protein-DNA interactions at a xenobiotic-responsive element: RT Copurification of dioxin receptor and DNA-binding affinity RL Proc. Natl. Acad. Sci. USA 86:60-64 (1989). XX // AC R00269 XX ID RAT$CYTOP_03 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE P-450c (cytochrome P-450c, P450 IA1); Gene: G000734. XX SQ GAGTTGGGT. XX EL DRE XX SF -1068 ST -1019 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0104; HepG2 SO 0107; HePac4 XX MM gel retardation XX DR EMBL: M14633; RNCP45OC (3215:3223). XX RN [1] RX MEDLINE; 89098930. RA Hapgood J., Cuthill S., Denis M., Poellinger L., Gustafsson J.-A. RT Specific protein-DNA interactions at a xenobiotic-responsive element: RT Copurification of dioxin receptor and DNA-binding affinity RL Proc. Natl. Acad. Sci. USA 86:60-64 (1989). XX // AC R00270 XX ID RAT$CYTOP_04 XX DT 20.06.1990 (created); ewi. DT 12.11.1997 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE P-450c (cytochrome P-450c, P450 IA1); Gene: G000734. XX SQ cctccaggctcttctCACGCaactc. XX EL XRE1 XX SF -1029 ST -1005 XX BF T00018; AhR; Quality: 1; Species: mouse, Mus musculus. BF T00019; AhR; Quality: 4; Species: rat, Rattus norvegicus. BF T01797; Arnt; Quality: 1; Species: mouse, Mus musculus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0106; HePa-1+ SO 0107; HePac4 SO 0234; LCS7 SO 0289; rl SO 0326; rec(mouse-ret lys) SO 0423; HePac4 + dioxin SO 0875; HePa C12 XX MM copper/phenanthroline footprinting MM functional analysis MM direct gel shift MM supershift (antibody binding) MM in vivo / genomic methylation protection MM methylation interference XX CC dioxin receptor binding depends on dioxin induction, binding of the CC constitutive factor (2.8S, 53 kDa) is unaffected by xenobiotics; AhR/Arnt CC binding is induced by TCDD or beta-naphthoflavone [2], by indolocarbazoles CC ICZ, MICZ, BICZ [3] XX DR TRANSPATH: XN000007014 DR TRANSPATH: XN000007016 DR TRANSPATH: XN000009019 DR EMBL: M14633; RNCP45OC (3243:3267). XX RN [1] RX MEDLINE; 95124333. RA Antonsson C., Whitelaw M. L., McGuire J., Gustafsson J. -A., Poellinger L. RT Distinct roles of the molecular chaperone hsp90 in modulating dioxin RT receptor function via the basic helix-loop-helix and PAS domains RL Mol. Cell. Biol. 15:756-765 (1995). RN [2] RX MEDLINE; 94344074. RA Reick M., Robertson R. W., Pasco D. S., Fagan J. B. RT Down-regulation of nuclear aryl hydrocarbon receptor DNA-binding and RT transactivation functions: requirement for a labile or inducible factor RL Mol. Cell. Biol. 14:5653-5660 (1994). RN [3] RX MEDLINE; 94148975. RA Kleman M. I., Poellinger L., Gustafsson J. A. RT Regulation of human dioxin receptor function by indolocabazoles, receptor RT ligands of dietary origin RL J. Biol. Chem. 269:5137-5144 (1994). RN [4] RX MEDLINE; 94140877. RA Mason G. G. F., Witte A. M., Whitelaw M. L., Antonsson C., McGuire J., RA Wilhelmsson A., Poellinger L., Gustafsson J. A. RT Purification of the DNA binding form of dioxin receptor RL J. Biol. Chem. 269:4438-4449 (1994). RN [5] RX MEDLINE; 91358481. RA Pongratz I., Stroemstedt P.-E., Mason G. G. F., Poellinger L. RT Inhibition of the specific DNA binding activity of the dioxin receptor by RT phosphatase treatment RL J. Biol. Chem. 266:16813-16817 (1991). RN [6] RX MEDLINE; 91094856. RA Cuthill S., Wilhelmsson A., Poellinger L. RT Role of the ligand in intracellular receptor function: Receptor affinity RT determines activation in vitro of the latent dioxin receptor to a RT DNA-binding form RL Mol. Cell. Biol. 11:401-411 (1991). RN [7] RX MEDLINE; 91342630. RA Hapgood J., Cuthill S., Soederkvist P., Wilhelmsson A., Pongratz I., Tukey RA R. H., Johnson E. F., Gustafsson J.-A., Poellinger L. RT Liver cells contain constitutive DNase I-hypersensitive sites at the RT xenobiotic response elements 1 and 2 (XRE1 and -2) of the rat cytochrome RT P-450IA1 gene and a constitutive, nuclear XRE-binding factor that is RT distinct from the dioxin receptor RL Mol. Cell. Biol. 11:4314-4323 (1991). RN [8] RX MEDLINE; 90107962. RA Wilhelmsson A., Cuthill S., Denis M., Wikstroem A.-C., Gustafsson J. A., RA Poellinger L. RT The specific DNA binding activity of the dioxin receptor is modulated by RT the 90 kd heat shock protein RL EMBO J. 9:69-76 (1990). RN [9] RX MEDLINE; 90130485. RA Nemoto T., Mason G. F., Wilhelmsson A., Cuthill S., Hapgood J., Gustafsson RA J. A., Poellinger L. RT Activation of the Dioxin and Glucocorticoid Receptors to a DNA Binding RT State under Cell-free Conditions RL J. Biol. Chem. 256:2269-2277 (1990). RN [10] RX MEDLINE; 90264416. RA Saatcioglu F., Perry D. J., Pasco D. S., Fagan J. B. RT Aryl Hydrocarbon (Ah) Receptor DNA-binding Activity RL J. Biol. Chem. 265:9251-9258 (1990). RN [11] RX MEDLINE; 91061748. RA Saatcioglu F., Perry D. J., Pasco D. S., Fagan J. B. RT Multiple DNA-binding factors interact with overlapping specificities at the RT aryl hydrocarbon response element of the cytochrome P450IA1 gene RL Mol. Cell. Biol. 10:6408-6416 (1990). RN [12] RX MEDLINE; 89098930. RA Hapgood J., Cuthill S., Denis M., Poellinger L., Gustafsson J.-A. RT Specific protein-DNA interactions at a xenobiotic-responsive element: RT Copurification of dioxin receptor and DNA-binding affinity RL Proc. Natl. Acad. Sci. USA 86:60-64 (1989). RN [13] RX MEDLINE; 88320343. RA Fujisawa-Sehara A., Yamane M., Fuji-Kuriyama Y. RT A DNA-binding factor specific for xenobiotic responsive elements of P-450c RT gene exists as a cryptic form in cytoplasm: Its possible translocation to RT nucleus RL Proc. Natl. Acad. Sci. USA 85:5859-5863 (1988). XX // AC R00272 XX ID RAT$CYTOP_05 XX DT 20.06.1990 (created); ewi. DT 05.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE P-450c (cytochrome P-450c, P450 IA1); Gene: G000734. XX SQ TCTCACGCAA. XX EL XRE XX SF -993 ST -990 XX BF T00018; AhR; Quality: 6; Species: mouse, Mus musculus. BF T01346; Arnt; Quality: 6; Species: human, Homo sapiens. BF T01797; Arnt; Quality: 6; Species: mouse, Mus musculus. BF T01798; Arnt; Quality: 6; Species: rat, Rattus norvegicus. BF T01796; Arnt (774 AA form); Quality: 6; Species: human, Homo sapiens. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0106; HePa-1+ XX MM direct gel shift MM methylation interference XX CC Arnt is involved in and required for Ah receptor binding to the XRE XX DR TRANSPATH: XN000007014 DR TRANSPATH: XN000008772 DR TRANSPATH: XN000009018 DR TRANSPATH: XN000009019 DR TRANSPATH: XN000009020 DR EMBL: M14633; RNCP45OC (3255:3264). XX RN [1] RX MEDLINE; 91240280. RA Hoffman E. C., Reyes H., Chu F.-F., Sander F., Conley H., Brooks B. A., RA Hankinson O. RT Cloning of a factor required for activity of the Ah (dioxin) receptor RL Science 252:954-958 (1991). RN [2] RX MEDLINE; 89343956. RA Neuhold L. A., Shirayoshi Y., Ozato K., Jones J. E., Nebert D. W. RT Regulation of Mouse CYP1A1 Gene Expression by Dioxin: Requirement of Two RT cis-Acting Elements during Induction RL Mol. Cell. Biol. 9:2378-2386 (1989). XX // AC R00273 XX ID RAT$CYTOP_06 XX DT 20.06.1990 (created); ewi. DT 30.04.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE P-450c (cytochrome P-450c, P450 IA1); Gene: G000734. XX SQ CCCGACCTCTGCCCCC. XX SF -938 ST -927 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0605; HePa-1 XX MM gel retardation MM methylation interference XX DR EMBL: M14633; RNCP45OC (3310:3325). XX RN [1] RX MEDLINE; 89343956. RA Neuhold L. A., Shirayoshi Y., Ozato K., Jones J. E., Nebert D. W. RT Regulation of Mouse CYP1A1 Gene Expression by Dioxin: Requirement of Two RT cis-Acting Elements during Induction RL Mol. Cell. Biol. 9:2378-2386 (1989). XX // AC R00274 XX ID RAT$CYTOP_07 XX DT 20.06.1990 (created); ewi. DT 30.04.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE P-450c (cytochrome P-450c, P450 IA1); Gene: G000734. XX SF -147 ST -122 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0605; HePa-1 XX MM DNase I footprinting MM gel retardation XX RN [1] RX MEDLINE; 90205824. RA Yanagida A., Sogawa K., Yasomoto K.-I., Fujii-Kuriyama Y. RT A Novel cis-Acting DNA Element Required for a High Level of Inducible RT Expression of the Rat P-450c Gene RL Mol. Cell. Biol. 10:1470-1475 (1990). XX // AC R00275 XX ID RAT$CYTOP_08 XX DT 20.06.1990 (created); ewi. DT 17.11.1999 (updated); mkl. CO Copyright (C), Biobase GmbH. XX TY D XX DE P-450c (cytochrome P-450c, P450 IA1); Gene: G000734. XX SQ cagagaaggAGGCGTGGCCaac. XX EL BTE XX SF -61 ST -41 XX BF T02210; BTEB1; Quality: 2; Species: rat, Rattus norvegicus. BF T00754; Sp1; Quality: 2; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0301; rec(rat-E.coli) SO 0605; HePa-1 XX MM DNase I footprinting MM copper/phenanthroline footprinting MM gel retardation MM gel shift competition MM methylation interference XX CC binding protein: BTE-binding factor [2] XX DR TRANSPATH: XN000009174 DR EMBL: M14633; RNCP45OC (4211:4231). DR EMBL: K02246; RNCYP45C (505:526). XX RN [1] RX MEDLINE; 94103188. RA Sogawa K., Kikuchi Y., Imataka H., Fujii-Kuriyama Y. RT Comparison of DNA-binding properties between BTEB and Sp1 RL J. Biochem. 114:605-609 (1993). RN [2] RX MEDLINE; 90205824. RA Yanagida A., Sogawa K., Yasomoto K.-I., Fujii-Kuriyama Y. RT A Novel cis-Acting DNA Element Required for a High Level of Inducible RT Expression of the Rat P-450c Gene RL Mol. Cell. Biol. 10:1470-1475 (1990). XX // AC R00276 XX ID DIDI$DG17_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE DG17; Gene: G000087. XX SQ ATGTGTGTTCATGTGTGTTTGAGTGTGTT. XX EL B3 XX SF -257 ST -228 XX BF T00315; GBF; Quality: 6; Species: slime mould, Dictyostelium discoideum. XX MX M00633; F$GBF_Q6 XX OS slime mould, Dictyostelium discoideum OC Eukaryota; Dictyosteliida; Dictyostelium. XX MM gel retardation MM methylation interference XX DR EMBL: M18106; DDDG17A (220:248). XX RN [1] RX MEDLINE; 90249746. RA Hjorth A. L., Pears C., Williams J. G., Firtel R. A. RT A developmentally regulated trans-acting factor recognizes dissimilar RT G/C-rich elements controlling a class of cAMP-inducible Dictyostelium genes RL Genes Dev. 4:419-432 (1990). XX // AC R00277 XX ID DIDI$DG17_02 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE DG17; Gene: G000087. XX SQ TTGGGGGTATGGTGGAGTT. XX EL B4 XX SF -156 ST -138 XX BF T00315; GBF; Quality: 6; Species: slime mould, Dictyostelium discoideum. XX MX M00633; F$GBF_Q6 XX OS slime mould, Dictyostelium discoideum OC Eukaryota; Dictyosteliida; Dictyostelium. XX MM gel retardation MM methylation interference XX DR EMBL: M18106; DDDG17A (130:148). XX RN [1] RX MEDLINE; 90249746. RA Hjorth A. L., Pears C., Williams J. G., Firtel R. A. RT A developmentally regulated trans-acting factor recognizes dissimilar RT G/C-rich elements controlling a class of cAMP-inducible Dictyostelium genes RL Genes Dev. 4:419-432 (1990). XX // AC R00278 XX ID HS$DHFR_01 XX DT 20.06.1990 (created); ewi. DT 14.10.2001 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE DHFR (dihydrofolate reductase); Gene: G000241. XX SF -760 ST -670 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM DNase I footprinting MM exonuclease III XX RN [1] RX MEDLINE; 86111796. RA Shimada T., Inokuchi K., Nienhuis A. W. RT Chromatin structure of the human dihydrofolate reductase gene promoter RL J. Biol. Chem. 261:1445-1452 (1986). XX // AC R00279 XX ID HS$DHFR_02 XX DT 20.06.1990 (created); ewi. DT 14.10.2001 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE DHFR (dihydrofolate reductase); Gene: G000241. XX SF -340 ST -270 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM DNase I footprinting MM exonuclease III XX RN [1] RX MEDLINE; 86111796. RA Shimada T., Inokuchi K., Nienhuis A. W. RT Chromatin structure of the human dihydrofolate reductase gene promoter RL J. Biol. Chem. 261:1445-1452 (1986). XX // AC R00280 XX ID HS$DHFR_03 XX DT 20.06.1990 (created); ewi. DT 14.10.2001 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE DHFR (dihydrofolate reductase); Gene: G000241. XX SF -270 ST -170 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM DNase I footprinting MM exonuclease III XX RN [1] RX MEDLINE; 86111796. RA Shimada T., Inokuchi K., Nienhuis A. W. RT Chromatin structure of the human dihydrofolate reductase gene promoter RL J. Biol. Chem. 261:1445-1452 (1986). XX // AC R00281 XX ID MOUSE$DHFR_01 XX DT 20.06.1990 (created); ewi. DT 29.04.1996 (updated); dbo. CO Copyright (C), Biobase GmbH. XX TY D XX DE DHFR (dihydrofolate reductase); Gene: G000501. XX SQ GGGGCGGAGC. SQ GGGGCGGGGC. SQ GGGGCGGAGC. SQ GGGGCGGGGC. XX BF T00752; Sp1; Quality: 4; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa XX MM DNase I footprinting MM competitive DNAse I footprint XX CC each sequence two-fold present; 4 binding sites between -250 and +1 XX DR TRANSPATH: XN000008062 DR EMBL: M11419; MMDHFRP (17:26). DR EMBL: M11419; MMDHFRP (65:74). DR EMBL: M11419; MMDHFRP (113:122). DR EMBL: M11419; MMDHFRP (161:170). DR EMBL: M13628; MMDHFRPA (45:54). DR EMBL: M13628; MMDHFRPA (93:102). DR EMBL: M13628; MMDHFRPA (141:150). DR EMBL: M13628; MMDHFRPA (189:198). DR EMBL: M37141; MMREPA (60:69). DR EMBL: M37141; MMREPA (108:117). DR EMBL: M37141; MMREPA (156:165). DR EMBL: M37141; MMREPA (204:213). DR EMBL: M37142; MMREPB (60:69). DR EMBL: M37142; MMREPB (108:117). DR EMBL: M37142; MMREPB (198:207). DR EMBL: M37143; MMREPC (60:69). DR EMBL: M37143; MMREPC (108:117). DR EMBL: M37143; MMREPC (156:165). DR EMBL: M37143; MMREPC (204:213). XX RN [1] RX MEDLINE; 86118666. RA Dynan W. S., Sazer S., Tjian R., Schimke R. T. RT Transcription factor Sp1 recognizes a DNA sequence in the mouse RT dihydrofolate reductase promoter RL Nature 319:246-248 (1986). XX // AC R00282 XX ID MOUSE$DHFR_02 XX DT 20.06.1990 (created); ewi. DT 29.04.1996 (updated); dbo. CO Copyright (C), Biobase GmbH. XX TY D XX DE DHFR (dihydrofolate reductase); Gene: G000501. XX SQ TTTCCCGC. XX SF -217 ST -40 XX BF T00246; EIIaE-A; Quality: 6; Species: human, Homo sapiens. BF T00752; Sp1; Quality: 5; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa XX MM DNase I footprinting XX CC 4-5 Sp1 sites XX DR TRANSPATH: XN000007373 DR TRANSPATH: XN000008062 XX RN [1] RX MEDLINE; 90205815. RA Farnham P. J., Means A. L. RT Sequences downstream of the transcription initiation site modulate the RT actitvity of the murine dihydrofolate reductase promoter RL Mol. Cell. Biol. 10:1390-1398 (1990). XX // AC R00283 XX ID MOUSE$DHFR_03 XX DT 20.06.1990 (created); ewi. DT 29.04.1996 (updated); dbo. CO Copyright (C), Biobase GmbH. XX TY D XX DE DHFR (dihydrofolate reductase); Gene: G000501. XX SF -12 ST 10 XX BF T00366; HIP1; Quality: 6; Species: human, Homo sapiens. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa XX MM DNase I footprinting XX DR TRANSPATH: XN000007495 XX RN [1] RX MEDLINE; 90205815. RA Farnham P. J., Means A. L. RT Sequences downstream of the transcription initiation site modulate the RT actitvity of the murine dihydrofolate reductase promoter RL Mol. Cell. Biol. 10:1390-1398 (1990). XX // AC R00284 XX ID MOUSE$DHFR_04 XX DT 20.06.1990 (created); ewi. DT 29.04.1996 (updated); dbo. CO Copyright (C), Biobase GmbH. XX TY D XX DE DHFR (dihydrofolate reductase); Gene: G000501. XX RE 5'-UTR XX SQ CCCCGCTGCCATC. XX SF 46 ST 56 XX BF T00278; delta factor; Quality: 4; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa SO 0326; rec(mouse-ret lys) XX MM DNase I footprinting MM gel shift competition XX DR TRANSPATH: XN000007429 DR EMBL: V00735; MMDHF5 (430:442). DR EMBL: M13628; MMDHFRPA (289:301). DR EMBL: M10071; MMFO5E (995:1007). DR EPD: EP07057; MM_DYR_2. XX RN [1] RX MEDLINE; 90205815. RA Farnham P. J., Means A. L. RT Sequences downstream of the transcription initiation site modulate the RT actitvity of the murine dihydrofolate reductase promoter RL Mol. Cell. Biol. 10:1390-1398 (1990). RN [2] RX MEDLINE; 89313753. RA Atchison M. L., Meyuhas O., Perry R. P. RT Localization of Transcriptional Regulatory Elements and Nuclear Factor RT Binding Sites in Mouse Ribosomal Protein Gene rpL32 RL Mol. Cell. Biol. 9:2067-2074 (1989). XX // AC R00285 XX ID MOUSE$DHFR_05 XX DT 20.06.1990 (created); ewi. DT 29.04.1996 (updated); dbo. CO Copyright (C), Biobase GmbH. XX TY D XX DE DHFR (dihydrofolate reductase); Gene: G000501. XX RE exon 1 XX SQ GGATTGGC. XX SF 101 ST 116 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa XX MM DNase I footprinting XX DR EMBL: V00735; MMDHF5 (489:496). DR EMBL: M10071; MMFO5E (1054:1061). XX RN [1] RX MEDLINE; 90205815. RA Farnham P. J., Means A. L. RT Sequences downstream of the transcription initiation site modulate the RT actitvity of the murine dihydrofolate reductase promoter RL Mol. Cell. Biol. 10:1390-1398 (1990). XX // AC R00286 XX ID MOUSE$DHFR_06 XX DT 20.06.1990 (created); ewi. DT 29.04.1996 (updated); dbo. CO Copyright (C), Biobase GmbH. XX TY D XX DE DHFR (dihydrofolate reductase); Gene: G000501. XX RE intron I XX SQ GGTATTGGC. XX SF 141 ST 154 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa XX MM DNase I footprinting XX DR EMBL: V00735; MMDHF5 (528:536). DR EMBL: M10071; MMFO5E (1093:1101). XX RN [1] RX MEDLINE; 90205815. RA Farnham P. J., Means A. L. RT Sequences downstream of the transcription initiation site modulate the RT actitvity of the murine dihydrofolate reductase promoter RL Mol. Cell. Biol. 10:1390-1398 (1990). XX // AC R00287 XX ID HS$DPOLB_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE POLB (DNA polymerase beta); Gene: G000243. XX SQ GCCCCGCCCCGCCCCGCCC. XX EL A XX SF -75 ST -56 XX BF T00759; Sp1; Quality: 5; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation XX DR EMBL: J04201; HSPOLBA (1080:1098). XX RN [1] RX MEDLINE; 90192168. RA Englander E. W., Wilson S. H. RT Protein binding elements in the human beta-polymerase promoter RL Nucleic Acids Res. 18:919-928 (1990). XX // AC R00288 XX ID HS$DPOLB_02 XX DT 20.06.1990 (created); ewi. DT 06.12.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE POLB (DNA polymerase beta); Gene: G000243. XX SQ GACGCGTGACGTCACAACAAGC. XX EL B XX SF -54 ST -33 XX BF T00446; 43K protein; Quality: 6; Species: rat, Rattus norvegicus. BF T00167; CRE-BP1; Quality: 5; Species: human, Homo sapiens. BF T00164; CREB; Quality: 4; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl SO 0491; CHO XX MM DNase I footprinting MM gel retardation XX CC conflict: last two nucleotides are CG in HSPOLBA XX DR TRANSPATH: XN000005747 DR TRANSPATH: XN000005748 DR TRANSPATH: XN000007591 DR EMBL: J04201; HSPOLBA (1101:1122). XX RN [1] RX MEDLINE; 91219445. RA Kedar P. S., Widen S. G., Englander E. W., Fornace jr A. J., Wilson S. H. RT The ATF/CREB transcription factor-binding site in the polymerase beta RT promoter mediates the positive effect of RT N-methyl-N'-nitro-N-nitrosoguanidine on transcription RL Proc. Natl. Acad. Sci. USA 88:3729-3733 (1991). RN [2] RX MEDLINE; 90192168. RA Englander E. W., Wilson S. H. RT Protein binding elements in the human beta-polymerase promoter RL Nucleic Acids Res. 18:919-928 (1990). XX // AC R00289 XX ID HS$DPOLB_03 XX DT 20.06.1990 (created); ewi. DT 12.05.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE POLB (DNA polymerase beta); Gene: G000243. XX SQ GTGCGCCCC. XX EL C XX SF -29 ST -21 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl SO 0392; testis XX MM DNase I footprinting MM gel retardation XX DR EMBL: J04201; HSPOLBA (1125:1133). XX RN [1] RX MEDLINE; 90192168. RA Englander E. W., Wilson S. H. RT Protein binding elements in the human beta-polymerase promoter RL Nucleic Acids Res. 18:919-928 (1990). XX // AC R00290 XX ID HS$DPOLB_04 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE POLB (DNA polymerase beta); Gene: G000243. XX SQ gCCCC. XX EL C XX SF -23 ST -20 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation XX DR EMBL: J04201; HSPOLBA (1129:1133). XX RN [1] RX MEDLINE; 90192168. RA Englander E. W., Wilson S. H. RT Protein binding elements in the human beta-polymerase promoter RL Nucleic Acids Res. 18:919-928 (1990). XX // AC R00291 XX ID HS$DPOLB_05 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE POLB (DNA polymerase beta); Gene: G000243. XX SQ ATCG. XX EL D XX SF -13 ST -10 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation XX DR EMBL: J04201; HSPOLBA (1141:1144). XX RN [1] RX MEDLINE; 90192168. RA Englander E. W., Wilson S. H. RT Protein binding elements in the human beta-polymerase promoter RL Nucleic Acids Res. 18:919-928 (1990). XX // AC R00292 XX ID HS$DPOLB_06 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE POLB (DNA polymerase beta); Gene: G000243. XX SQ CTCCTGCTCCCGTCT. XX EL E XX SF 33 ST 47 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0289; rl XX MM DNase I footprinting MM gel retardation XX DR EMBL: J04201; HSPOLBA (1186:1200). XX RN [1] RX MEDLINE; 90192168. RA Englander E. W., Wilson S. H. RT Protein binding elements in the human beta-polymerase promoter RL Nucleic Acids Res. 18:919-928 (1990). XX // AC R00293 XX ID DROME$DDC_01 XX DT 20.06.1990 (created); ewi. DT 31.05.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Ddc (dopa decarboxylase); Gene: G000094. XX SQ CAGCGGCTGCGGA. XX SF -93 ST -76 XX BF T00008; Adf-1; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX MM DNase I footprinting XX CC conflict: DMDDC (1547:1559) ends...AT XX DR EMBL: X04661; DMDDC (1547:1559). DR Flybase: FBgn0000422; Ddc. XX RN [1] RX MEDLINE; 90202990. RA England B. P., Heberlein U., Tjian R. RT Purified Drosophila Transcription Factor, Adh Distal Factor-1 (Adf-1), RT Binds to Sites in Several Drosophila Promoters and Activates Transcription RL J. Biol. Chem. 265:5086-5094 (1990). XX // AC R00294 XX ID DROME$DDC_02 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE Ddc (dopa decarboxylase); Gene: G000094. XX SQ TGAACCGGTCCTGCGG. XX EL element I XX SF -75 ST -60 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0504; Drosophila embryos XX MM DNase I footprinting XX DR EMBL: X04661; DMDDC (1567:1582). DR Flybase: FBgn0000422; Ddc. XX RN [1] RX MEDLINE; 90108664. RA Dynlacht B. D., Attardi L. D., Admon A., Freeman M., Tjian R. RT Functional analysis of NTF-1, a developmentally regulated Drosophila RT transcription factor that binds neuronal cis elements RL Genes Dev. 3:1677-1688 (1989). RN [2] RX MEDLINE; 88196079. RA Bray S. J., Johnson W. A., Hirsh J., Heberlein U., Tjian R. RT A cis-acting element and associated binding factor required for CNS RT expression of the Drosophila melanogaster dopa decarboxylase gene RL EMBO J. 7:177-188 (1988). XX // AC R00295 XX ID EBV$DSL_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE DSL; Gene: G000139. XX SQ TTGCTCA. XX EL ZRE7 XX SF -976 ST -970 XX BF T00923; Zta; Quality: 2; Species: EBV, Epstein-Barr virus. XX MX M00711; V$ZTA_Q2 XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0302; rec(EBV-E.coli) XX MM DNase I footprinting MM gel retardation XX DR EMBL: V01555; EBV (-53741:-53735). XX RN [1] RX MEDLINE; 90156511. RA Lieberman P. M., Hardwick J. M., Sample J., Hayward G. S., Hayward S. D. RT The Zta Transactivator Involved in Induction of Lytic Cycle Gene Expression RT in Epstein-Barr Virus-Infected Lymphocytes Binds to Both AP-1 and ZRE Sites RT in Target Promoter and Enhancer Regions RL J. Virol. 64:1143-1155 (1990). XX // AC R00296 XX ID EBV$DSL_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE DSL; Gene: G000139. XX SQ TGTGTCA. XX EL ZRE6 XX SF -859 ST -840 XX BF T00923; Zta; Quality: 2; Species: EBV, Epstein-Barr virus. XX MX M00711; V$ZTA_Q2 XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0302; rec(EBV-E.coli) XX MM DNase I footprinting MM gel retardation XX DR EMBL: V01555; EBV (-53636:-53630). XX RN [1] RX MEDLINE; 90156511. RA Lieberman P. M., Hardwick J. M., Sample J., Hayward G. S., Hayward S. D. RT The Zta Transactivator Involved in Induction of Lytic Cycle Gene Expression RT in Epstein-Barr Virus-Infected Lymphocytes Binds to Both AP-1 and ZRE Sites RT in Target Promoter and Enhancer Regions RL J. Virol. 64:1143-1155 (1990). XX // AC R00297 XX ID EBV$DSL_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE DSL; Gene: G000139. XX SQ TGTGCAA. XX EL ZRE5 XX SF -711 ST -682 XX BF T00923; Zta; Quality: 2; Species: EBV, Epstein-Barr virus. XX MX M00711; V$ZTA_Q2 XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0302; rec(EBV-E.coli) XX MM DNase I footprinting MM gel retardation XX DR EMBL: V01555; EBV (-53477:-53471). XX RN [1] RX MEDLINE; 90156511. RA Lieberman P. M., Hardwick J. M., Sample J., Hayward G. S., Hayward S. D. RT The Zta Transactivator Involved in Induction of Lytic Cycle Gene Expression RT in Epstein-Barr Virus-Infected Lymphocytes Binds to Both AP-1 and ZRE Sites RT in Target Promoter and Enhancer Regions RL J. Virol. 64:1143-1155 (1990). XX // AC R00298 XX ID EBV$DSL_04 XX DT 20.06.1990 (created); ewi. DT 04.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE DSL; Gene: G000139. XX SQ TGACACA. XX EL ZRE4/TGTG2 XX SF -148 ST -132 XX BF T00923; Zta; Quality: 2; Species: EBV, Epstein-Barr virus. XX MX M00711; V$ZTA_Q2 XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0302; rec(EBV-E.coli) XX MM DNase I footprinting MM gel retardation XX DR EMBL: V01555; EBV (-52929:-52923). XX RN [1] RX MEDLINE; 90156511. RA Lieberman P. M., Hardwick J. M., Sample J., Hayward G. S., Hayward S. D. RT The Zta Transactivator Involved in Induction of Lytic Cycle Gene Expression RT in Epstein-Barr Virus-Infected Lymphocytes Binds to Both AP-1 and ZRE Sites RT in Target Promoter and Enhancer Regions RL J. Virol. 64:1143-1155 (1990). XX // AC R00299 XX ID EBV$DSL_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE DSL; Gene: G000139. XX SQ TGACACA. XX EL ZRE3/TGTG1 XX SF -115 ST -101 XX BF T00923; Zta; Quality: 2; Species: EBV, Epstein-Barr virus. XX MX M00711; V$ZTA_Q2 XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0302; rec(EBV-E.coli) XX MM DNase I footprinting MM gel retardation XX DR EMBL: V01555; EBV (-52896:-52890). XX RN [1] RX MEDLINE; 90156511. RA Lieberman P. M., Hardwick J. M., Sample J., Hayward G. S., Hayward S. D. RT The Zta Transactivator Involved in Induction of Lytic Cycle Gene Expression RT in Epstein-Barr Virus-Infected Lymphocytes Binds to Both AP-1 and ZRE Sites RT in Target Promoter and Enhancer Regions RL J. Virol. 64:1143-1155 (1990). XX // AC R00300 XX ID EBV$DSL_06 XX DT 20.06.1990 (created); ewi. DT 07.06.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE DSL; Gene: G000139. XX SQ CCAAT. XX SF -98 ST -84 XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0302; rec(EBV-E.coli) XX MM DNase I footprinting MM gel retardation XX DR EMBL: V01555; EBV (-52879:-52875). XX RN [1] RX MEDLINE; 90156511. RA Lieberman P. M., Hardwick J. M., Sample J., Hayward G. S., Hayward S. D. RT The Zta Transactivator Involved in Induction of Lytic Cycle Gene Expression RT in Epstein-Barr Virus-Infected Lymphocytes Binds to Both AP-1 and ZRE Sites RT in Target Promoter and Enhancer Regions RL J. Virol. 64:1143-1155 (1990). XX // AC R00301 XX ID EBV$DSL_07 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE DSL; Gene: G000139. XX SQ TGAGCAA. XX EL ZRE2 XX SF -77 ST -62 XX BF T00923; Zta; Quality: 2; Species: EBV, Epstein-Barr virus. XX MX M00711; V$ZTA_Q2 XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0302; rec(EBV-E.coli) XX MM DNase I footprinting MM gel retardation XX DR EMBL: V01555; EBV (-52858:-52852). XX RN [1] RX MEDLINE; 90156511. RA Lieberman P. M., Hardwick J. M., Sample J., Hayward G. S., Hayward S. D. RT The Zta Transactivator Involved in Induction of Lytic Cycle Gene Expression RT in Epstein-Barr Virus-Infected Lymphocytes Binds to Both AP-1 and ZRE Sites RT in Target Promoter and Enhancer Regions RL J. Virol. 64:1143-1155 (1990). XX // AC R00302 XX ID EBV$DSL_08 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE DSL; Gene: G000139. XX SQ TTACACA. XX EL ZRE1 XX SF -59 ST -42 XX BF T00923; Zta; Quality: 2; Species: EBV, Epstein-Barr virus. XX MX M00711; V$ZTA_Q2 XX OS EBV, Epstein-Barr virus OC viridae; ds-DNA enveloped viruses; herpesviridae; gammaherpesviridae XX SO 0302; rec(EBV-E.coli) XX MM DNase I footprinting MM gel retardation XX DR EMBL: V01555; EBV (-52840:-52834). XX RN [1] RX MEDLINE; 90156511. RA Lieberman P. M., Hardwick J. M., Sample J., Hayward G. S., Hayward S. D. RT The Zta Transactivator Involved in Induction of Lytic Cycle Gene Expression RT in Epstein-Barr Virus-Infected Lymphocytes Binds to Both AP-1 and ZRE Sites RT in Target Promoter and Enhancer Regions RL J. Virol. 64:1143-1155 (1990). XX // AC R00303 XX ID MOUSE$E1_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E1 (embryo stem cell specific enhancer E1); Gene: G000504. XX SQ TTAAAATTCA. XX EL en-like element within E1 XX BF T00644; POU2F1a; Quality: 4; Species: mouse, Mus musculus. BF T01862; POU2F1b; Quality: 4; Species: mouse, Mus musculus. BF T01863; POU2F1c; Quality: 4; Species: mouse, Mus musculus. BF T00651; POU5F1; Quality: 6; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0168; P19 D- XX MM DNase I footprinting MM gel retardation MM gel shift competition XX DR TRANSPATH: XN000009047 DR TRANSPATH: XN000009052 XX RN [1] RX MEDLINE; 90150273. RA Okamoto K., Okazawa H., Okuda A., Sakai M., Muramatsu M., Hamada H. RT A novel octamer binding transcription factor is differentially expressed in RT mouse embryonic cells RL Cell 60:461-472 (1990). XX // AC R00304 XX ID MOUSE$E1_02 XX DT 20.06.1990 (created); ewi. DT 16.05.2001 (updated); rio. CO Copyright (C), Biobase GmbH. XX TY D XX DE E1 (embryo stem cell specific enhancer E1); Gene: G000504. XX SQ caacgccatacTTAAAATTCAActagaaagtg. XX EL en-like element within E1 XX BF T00644; POU2F1a; Quality: 4; Species: mouse, Mus musculus. BF T01862; POU2F1b; Quality: 4; Species: mouse, Mus musculus. BF T01863; POU2F1c; Quality: 4; Species: mouse, Mus musculus. BF T00651; POU5F1; Quality: 6; Species: mouse, Mus musculus. BF T04470; POU6F1; Quality: 2; Species: human, Homo sapiens. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0169; P19 D+ SO 0306; rec(human-E.coli) XX MM DNase I footprinting MM gel retardation MM gel shift competition XX DR TRANSPATH: XN000009047 DR TRANSPATH: XN000009052 DR TRANSPATH: XN000009803 XX RN [1] RX MEDLINE; 94192665. RA Wey E., Lyons G. E., Schaefer B. W. RT A human POU domain gene, mPOU, is expressed in developing brain and RT specific adult tissues RL Eur. J. Biochem. 220:753-762 (1994). RN [2] RX MEDLINE; 90150273. RA Okamoto K., Okazawa H., Okuda A., Sakai M., Muramatsu M., Hamada H. RT A novel octamer binding transcription factor is differentially expressed in RT mouse embryonic cells RL Cell 60:461-472 (1990). XX // AC R00305 XX ID MOUSE$E1_03 XX DT 20.06.1990 (created); ewi. DT 23.01.1996 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E1 (embryo stem cell specific enhancer E1); Gene: G000504. XX SQ ATTAGCAT. XX EL OCTA element within E1, OCTA26 XX BF T00644; POU2F1a; Quality: 4; Species: mouse, Mus musculus. BF T01862; POU2F1b; Quality: 4; Species: mouse, Mus musculus. BF T01863; POU2F1c; Quality: 4; Species: mouse, Mus musculus. BF T00651; POU5F1; Quality: 6; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0168; P19 D- SO 0303; rec(mouse-E.coli) XX MM DNase I footprinting MM gel retardation MM gel shift competition XX CC Oct-3: isolated POU domain also binding XX DR TRANSPATH: XN000009047 DR TRANSPATH: XN000009052 DR EMBL: X51834; MMOESTEOP (5545:5552). XX RN [1] RX MEDLINE; 91360353. RA Imagawa M., Miyamoto A., Shirakawa M., Hamada H., Muramatsu M. RT Stringent integrity requirements for both trans-activation and DNA-binding RT in a trans-activator, Oct3 RL Nucleic Acids Res. 19:4503-4508 (1991). RN [2] RX MEDLINE; 90150273. RA Okamoto K., Okazawa H., Okuda A., Sakai M., Muramatsu M., Hamada H. RT A novel octamer binding transcription factor is differentially expressed in RT mouse embryonic cells RL Cell 60:461-472 (1990). XX // AC R00306 XX ID MOUSE$E1_04 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E1 (embryo stem cell specific enhancer E1); Gene: G000504. XX SQ ATTAGCAT. XX EL OCTA element within E1 XX BF T00644; POU2F1a; Quality: 4; Species: mouse, Mus musculus. BF T01862; POU2F1b; Quality: 4; Species: mouse, Mus musculus. BF T01863; POU2F1c; Quality: 4; Species: mouse, Mus musculus. BF T00651; POU5F1; Quality: 6; Species: mouse, Mus musculus. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0169; P19 D+ XX MM DNase I footprinting MM gel retardation MM gel shift competition XX DR TRANSPATH: XN000009047 DR TRANSPATH: XN000009052 DR EMBL: X51834; MMOESTEOP (5545:5552). XX RN [1] RX MEDLINE; 90150273. RA Okamoto K., Okazawa H., Okuda A., Sakai M., Muramatsu M., Hamada H. RT A novel octamer binding transcription factor is differentially expressed in RT mouse embryonic cells RL Cell 60:461-472 (1990). XX // AC R00307 XX ID AD2$E1A_01 XX DT 20.06.1990 (created); ewi. DT 07.02.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E1A (early gene 1A); Gene: G001624. XX SQ GATGTGGTAAA. XX EL enhancer XX SF -350 ST -335 XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX DR EMBL: J01917; HACG (156:166). DR EPD: EP07149; AD2_E1A. XX RN [1] RX MEDLINE; 87174795. RA Barrett P., Clark L., Hay R. T. RT A cellular protein binds to a conserved sequence in the adenovirus type 2 RT enhancer RL Nucleic Acids Res. 15:2719-2735 (1987). XX // AC R00308 XX ID AD2$E1A_02 XX DT 20.06.1990 (created); ewi. DT 07.02.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E1A (early gene 1A); Gene: G001624. XX SQ GTTGTAGTAAA. XX EL enhancer XX SF -273 ST -260 XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX DR EMBL: J01917; HACG (233:243). DR EPD: EP07149; AD2_E1A. XX RN [1] RX MEDLINE; 87174795. RA Barrett P., Clark L., Hay R. T. RT A cellular protein binds to a conserved sequence in the adenovirus type 2 RT enhancer RL Nucleic Acids Res. 15:2719-2735 (1987). XX // AC R00309 XX ID AD5$E1A_03 XX DT 20.06.1990 (created); ewi. DT 10.02.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E1A (early gene 1A); Gene: G000003. XX SQ TGACGTGT. XX SF -52 ST -21 XX BF T00163; CREB; Quality: 2; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM direct gel shift XX DR TRANSPATH: XN000005749 DR EMBL: X02996; AD5001 (456:463). DR EPD: EP11195; AD5_E1A. XX RN [1] RX MEDLINE; 88247984. RA Hardy S., Shenk T. RT Adenoviral control regions activated by E1A and the cAMP responsive element RT bind to the same factor RL Proc. Natl. Acad. Sci. USA 85:4171-4175 (1988). XX // AC R00310 XX ID AD5$E1A_04 XX DT 20.06.1990 (created); ewi. DT 09.02.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E1A (early gene 1A); Gene: G000003. XX RE enhancer XX SQ caatTTTCGCGcgg. XX SF -291 ST -278 XX BF T00221; E2F; Quality: 3; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM direct gel shift MM supershift (antibody binding) MM methylation interference XX DR TRANSPATH: XN000007340 DR EMBL: X02996; AD5001 (208:221). DR EPD: EP11195; AD5_E1A. XX RN [1] RX MEDLINE; 93140781. RA Chen S., West R. W., Johnson S. L., Gans H., Kruger B., Ma J. RT TSF3, a global regulatory protein that silences transcription of yeast GAL RT genes, also mediates repression by alpha2 repressor and is identical to SIN4 RL Mol. Cell. Biol. 13:831-840 (1993). RN [2] RX MEDLINE; 90066460. RA Hardy S., Shenk T. RT E2F from Adenovirus-Infected Cells Binds Cooperatively to DNA Containing RT Two Properly Oriented and Spaced Recognition Sites RL Mol. Cell. Biol. 9:4495-4506 (1989). RN [3] RX MEDLINE; 90098767. RA Yoshida K., Narita M., Fujinaga K. RT Binding sites of HeLa cell nuclear proteins on the upstream region of RT adenovirus type 5 E1A gene RL Nucleic Acids Res. 17:10015-10034 (1989). RN [4] RX MEDLINE; 87175637. RA Kovesdi I., Reichel R., Nevins J. R. RT Role of an adenovirus E2 promoter binding factor in E1A-mediated coordinate RT gene control RL Proc. Natl. Acad. Sci. USA 84:2180-2184 (1987). XX // AC R00311 XX ID AD5$E1A_05 XX DT 20.06.1990 (created); ewi. DT 09.02.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E1A (early gene 1A); Gene: G000003. XX RE enhancer XX SQ ccatTTTCGCGggaa. XX SF -228 ST -214 XX BF T00221; E2F; Quality: 6; Species: human, Homo sapiens. BF T00232; E2F+E4; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007340 DR TRANSPATH: XN000007351 DR EMBL: X02996; AD5001 (271:285). DR EPD: EP11195; AD5_E1A. XX RN [1] RX MEDLINE; 89378737. RA Hardy S., Engel D. A., Shenk T. RT An adenovirus early region 4 gene product is required for induction of the RT infection-specific form of cellular E2F activity RL Genes Dev. 3:1062-1074 (1989). RN [2] RX MEDLINE; 90066460. RA Hardy S., Shenk T. RT E2F from Adenovirus-Infected Cells Binds Cooperatively to DNA Containing RT Two Properly Oriented and Spaced Recognition Sites RL Mol. Cell. Biol. 9:4495-4506 (1989). RN [3] RX MEDLINE; 87175637. RA Kovesdi I., Reichel R., Nevins J. R. RT Role of an adenovirus E2 promoter binding factor in E1A-mediated coordinate RT gene control RL Proc. Natl. Acad. Sci. USA 84:2180-2184 (1987). XX // AC R00312 XX ID AD12$E1A_01 XX DT 20.06.1990 (created); ewi. DT 10.02.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E1A (early gene 1A); Gene: G001625. XX SQ TACTGGACTAGTGCCAATATT. XX S1 left end of viral DNA SF 22 ST 42 XX BF T00539; NF-1; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 12 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX CC corresponds to -284/-264 of distal transcription start site or -423/-403 of CC the proximal site XX DR EMBL: X14757; AD12E1A (22:42). XX RN [1] RX MEDLINE; 90122929. RA Koikeda S., Ibuki R., Sawada Y., Nagata K., Shibata H., Masamune Y., RA Nakanishi Y. RT Nuclear factor I stimulates transcription of the adenovirus 12 E1A RL Biochim. Biophys. Acta 1048:85-92 (1990). XX // AC R00313 XX ID AD12$E1A_02 XX DT 20.06.1990 (created); ewi. DT 10.02.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E1A (early gene 1A); Gene: G001625. XX SQ TACTGGACTAGTGCCAATATTAAAATGAAGTGG. XX S1 left end of viral DNA SF 22 ST 54 XX BF T00535; NF-1; Quality: 6; Species: rat, Rattus norvegicus. XX OS adenovirus type 12 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0510; Ehrl. ascites XX MM DNase I footprinting MM gel retardation XX CC corresponds to -284/-252 of distal transcription start site or -423/-391 of CC the proximal site XX DR TRANSPATH: XN000007721 DR EMBL: X14757; AD12E1A (22:54). XX RN [1] RX MEDLINE; 90122929. RA Koikeda S., Ibuki R., Sawada Y., Nagata K., Shibata H., Masamune Y., RA Nakanishi Y. RT Nuclear factor I stimulates transcription of the adenovirus 12 E1A RL Biochim. Biophys. Acta 1048:85-92 (1990). XX // AC R00314 XX ID AD12$E1A_03 XX DT 20.06.1990 (created); ewi. DT 10.02.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E1A (early gene 1A); Gene: G001625. XX SQ TGGAGGTGTGGCTTTGG. XX S1 left end of viral DNA SF 78 ST 94 XX OS adenovirus type 12 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0018; 293 (hu-HEK) SO 0100; HeLa SO 0510; Ehrl. ascites XX MM DNase I footprinting MM gel retardation XX CC corresponds to -228/-212 of distal transcription start site or -367/-351 of CC the proximal site XX DR EMBL: X14757; AD12E1A (78:94). XX RN [1] RX MEDLINE; 90122929. RA Koikeda S., Ibuki R., Sawada Y., Nagata K., Shibata H., Masamune Y., RA Nakanishi Y. RT Nuclear factor I stimulates transcription of the adenovirus 12 E1A RL Biochim. Biophys. Acta 1048:85-92 (1990). XX // AC R00315 XX ID AD2$E1B_03 XX DT 20.06.1990 (created); ewi. DT 02.01.2001 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E1B (early gene 1B); Gene: G000004. XX SQ ttaaatGGGGCGGGGCtaa. XX SF -45 ST -35 XX BF T02210; BTEB1; Quality: 2; Species: rat, Rattus norvegicus. BF T00490; MAZ; Quality: 2; Species: human, Homo sapiens. BF T00754; Sp1; Quality: 2; Species: rat, Rattus norvegicus. BF T00759; Sp1; Quality: 2; Species: human, Homo sapiens. XX MX M00649; V$MAZ_Q6 XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa SO 0301; rec(rat-E.coli) SO 0306; rec(human-E.coli) XX MM affinity chromatography MM DNase I footprinting MM gel shift competition MM primer extension footprint XX CC uppercase letters: Sp1 binding; conflict: EMBL #J01917 (1645:1663) is CC ttaaatggggcggggctTa XX DR TRANSPATH: XN000007654 DR TRANSPATH: XN000009175 DR EMBL: J01917; HACG (1645:1663). DR EPD: EP07150; AD2_E1B. XX RN [1] RX MEDLINE; 96224025. RA Parks C. L., Shenk T. RT The serotonin 1a receptor gene contains a TATA-less promoter that responds RT to MAZ and Sp1 RL J. Biol. Chem. 271:4417-4430 (1996). RN [2] RX MEDLINE; 94103188. RA Sogawa K., Kikuchi Y., Imataka H., Fujii-Kuriyama Y. RT Comparison of DNA-binding properties between BTEB and Sp1 RL J. Biochem. 114:605-609 (1993). RN [3] RX MEDLINE; 90014783. RA Schmidt M. C., Zhou Q., Berk A. J. RT Sp1 Activates Transcription without Enhancing DNA-Binding Activity of the RT TATA Box Factor RL Mol. Cell. Biol. 9:3299-3307 (1989). RN [4] RX MEDLINE; 87173017. RA Wu L., Rosser D. S. E., Schmidt M. C., Berk A. J. RT A TATA box implicated in E1A transcriptional activation of a simple RT adenovirus 2 promoter RL Nature 326:512-515 (1987). XX // AC R00316 XX ID AD$E2AE1_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SF -155 ST -128 XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM genomic in situ DNAse I footprinting XX RN [1] RX MEDLINE; 88142851. RA Devaux B., Albrecht G., Kedinger C. RT Identical Genomic Footprints of the Adenovirus EIIa Promoter Are Detected RT before and after EIa Induction RL Mol. Cell. Biol. 7:4560-4563 (1987). XX // AC R00317 XX ID AD$E2AE1_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SQ GTGGGATTTCCTT. XX EL element C XX SF -142 ST -129 XX BF T00248; EIIaE-Calpha; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007377 XX RN [1] RX MEDLINE; 88065522. RA Jalinot P., Devaux B., Kedinger C. RT The Abundance and In Vitro DNA Binding of Three Cellular Proteins RT Interacting with the Adenovirus EIIa Early Promoter Are Not Modified by the RT EIa Gene Products RL Mol. Cell. Biol. 7:3806-3817 (1987). RN [2] RX MEDLINE; 87146375. RA Boeuf H., Zajchowski D., Tamura T., Hauss C., Kedinger C. RT Specific cellular proteins bind to critical promoter sequences if the RT adenovirus early EIIa promoter RL Nucleic Acids Res. 15:509-527 (1987). XX // AC R00318 XX ID AD$E2AE1_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SQ AGCGCCATTATGAG. XX EL element C XX SF -127 ST -112 XX BF T00249; EIIaE-Cbeta; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007378 DR EMBL: J01917; HACG (27206:27219). DR EPD: EP07154; AD2_E3. DR EPD: EP07153; AD2_V33P. XX RN [1] RX MEDLINE; 88065522. RA Jalinot P., Devaux B., Kedinger C. RT The Abundance and In Vitro DNA Binding of Three Cellular Proteins RT Interacting with the Adenovirus EIIa Early Promoter Are Not Modified by the RT EIa Gene Products RL Mol. Cell. Biol. 7:3806-3817 (1987). XX // AC R00319 XX ID AD$E2AE1_04 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SF -105 ST -88 XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting XX RN [1] RX MEDLINE; 87146375. RA Boeuf H., Zajchowski D., Tamura T., Hauss C., Kedinger C. RT Specific cellular proteins bind to critical promoter sequences if the RT adenovirus early EIIa promoter RL Nucleic Acids Res. 15:509-527 (1987). XX // AC R00320 XX ID AD$E2AE1_05 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SF -96 ST -61 XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0069; F9 SO 0171; PCC 4 XX MM gel retardation XX RN [1] RX MEDLINE; 87187648. RA La Thangue N. B., Rigby P. W. RT An Adenovirus E1A-like Transcription Factor Is Regulated during the RT Differentiation of Murine Embryonal Carcinoma Cells RL Cell 49:507-513 (1987). XX // AC R00321 XX ID AD$E2AE1_06 XX DT 20.06.1990 (created); ewi. DT 08.07.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SQ GACGTAGTTTTCGCGC. XX SF -84 ST -68 XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM genomic / in vivo exonuclease III digest XX DR EMBL: J01917; HACG (-27167:-27152). XX RN [1] RX MEDLINE; 88142851. RA Devaux B., Albrecht G., Kedinger C. RT Identical Genomic Footprints of the Adenovirus EIIa Promoter Are Detected RT before and after EIa Induction RL Mol. Cell. Biol. 7:4560-4563 (1987). RN [2] RX MEDLINE; 86122886. RA Kovesdi I., Reichel R., Nevins J. R. RT E1A Transcription Induction: Enhanced Binding of a Factor to Upstream RT Promoter Sequences RL Science 231:719-722 (1986). XX // AC R00322 XX ID AD$E2AE1_07 XX DT 20.06.1990 (created); ewi. DT 28.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SQ CTACGTCA. XX SF -83 ST -69 XX BF T00442; 47-kDa CRE bind. prot.; Quality: 6; Species: rat, Rattus norvegicus. BF T00051; ATF; Quality: 4; Species: human, Homo sapiens. BF T00052; ATF-a; Quality: 4; Species: human, Homo sapiens. BF T00163; CREB; Quality: 2; Species: human, Homo sapiens. BF T00164; CREB; Quality: 6; Species: rat, Rattus norvegicus. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0366; brain SO 0393; HeLa Ad5 XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000005750 DR TRANSPATH: XN000005751 DR TRANSPATH: XN000005752 DR TRANSPATH: XN000007100 DR TRANSPATH: XN000007586 DR EMBL: J01917; HACG (27161:27168). DR EPD: EP07154; AD2_E3. DR EPD: EP07153; AD2_V33P. XX RN [1] RX MEDLINE; 90301459. RA Gaire M., Chatton B., Kedinger C. RT Isolation and characterization of two novel, closely related ATF cDNA RT clones from HeLa cells RL Nucleic Acids Res. 18:3467-3473 (1990). RN [2] RX MEDLINE; 89197969. RA Loeken M. R., Brady J. RT The Adenovirus EIIA Enhancer RL J. Biol. Chem. 264:6572-6579 (1989). RN [3] RX MEDLINE; 89214111. RA Kwast-Welfeld J., Soong C.-J., Short M. L., Jungmann R. A. RT Identification of Rat Ovarian Nuclear Factors That Interact with the RT cAMP-inducible Lactate Dehydrogenase A Subunit Promoter RL J. Biol. Chem. 264:6941-6947 (1989). RN [4] RX MEDLINE; 88247984. RA Hardy S., Shenk T. RT Adenoviral control regions activated by E1A and the cAMP responsive element RT bind to the same factor RL Proc. Natl. Acad. Sci. USA 85:4171-4175 (1988). XX // AC R00323 XX ID AD$E2AE1_08 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SQ AAACTACGTCATCTCCA. XX SF -82 ST -66 XX BF T00247; EIIaE-B; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007376 DR EMBL: J01917; HACG (27158:27174). DR EPD: EP07154; AD2_E3. DR EPD: EP07153; AD2_V33P. XX RN [1] RX MEDLINE; 88004418. RA Yee A. S., Reichel R., Kovesdi I., Nevins J. R. RT Promoter interaction of the E1A-inducible factor E2F and its potential role RT in the formation of a multi-component complex RL EMBO J. 6:2061-2068 (1987). RN [2] RX MEDLINE; 87317605. RA SivaRaman L., Thimmappaya B. RT Two promoter-specific host factors interact with adjacent sequences in an RT EIA-inducible adenovirus promoter RL Proc. Natl. Acad. Sci. USA 84:6112-6116 (1987). RN [3] RX MEDLINE; 86287364. RA SivaRaman L., Subramanian S., Thimmappaya B. RT Identification of a factor in HeLa cells specific for an upstream RT transcriptional control sequence of an EIA-inducible adenovirus promoter RT and its relative abundance in infected and uninfected cells RL Proc. Natl. Acad. Sci. USA 83:5914-5918 (1986). XX // AC R00324 XX ID AD$E2AE1_10 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SQ ACTACGTCATCTCCA. XX EL element B XX SF -82 ST -64 XX BF T00247; EIIaE-B; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007376 DR EMBL: J01917; HACG (27160:27174). DR EPD: EP07154; AD2_E3. DR EPD: EP07153; AD2_V33P. XX RN [1] RX MEDLINE; 88190096. RA Jalinot P., Wintzerith M., Gaire M., Hauss C., Egly J. M., Kedinger C. RT Purification and functional characterization of a cellular transcription RT factor that binds to an enhancer element within the adenovirus early EIIa RT promoter RL Proc. Natl. Acad. Sci. USA 85:2484-2488 (1988). RN [2] RX MEDLINE; 88065522. RA Jalinot P., Devaux B., Kedinger C. RT The Abundance and In Vitro DNA Binding of Three Cellular Proteins RT Interacting with the Adenovirus EIIa Early Promoter Are Not Modified by the RT EIa Gene Products RL Mol. Cell. Biol. 7:3806-3817 (1987). RN [3] RX MEDLINE; 87146375. RA Boeuf H., Zajchowski D., Tamura T., Hauss C., Kedinger C. RT Specific cellular proteins bind to critical promoter sequences if the RT adenovirus early EIIa promoter RL Nucleic Acids Res. 15:509-527 (1987). XX // AC R00325 XX ID AD$E2AE1_11 XX DT 20.06.1990 (created); ewi. DT 24.06.1993 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SQ GACGTAGTTTTCGCGCttaaatttgagaaagggcgcgaaactagtcctt. XX SF -74 ST -33 XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa SO 0104; HepG2 XX MM DNase I footprinting MM exonuclease III MM direct gel shift XX DR EMBL: J01917; HACG (-27167:-27119). XX RN [1] RX MEDLINE; 91319707. RA Spergel J. M., Chen-Kiang S. RT Interleukin 6 enhances a cellular activity that functionally substitutes RT for E1A protein in transactivation RL Proc. Natl. Acad. Sci. USA 88:6472-6476 (1991). RN [2] RX MEDLINE; 88065522. RA Jalinot P., Devaux B., Kedinger C. RT The Abundance and In Vitro DNA Binding of Three Cellular Proteins RT Interacting with the Adenovirus EIIa Early Promoter Are Not Modified by the RT EIa Gene Products RL Mol. Cell. Biol. 7:3806-3817 (1987). XX // AC R00326 XX ID AD$E2AE1_12 XX DT 20.06.1990 (created); ewi. DT 17.10.2001 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SQ aatttaaGCGCGAAAacta. XX SF -71 ST -53 XX BF T00198; DRTF1; Quality: 6; Species: mouse, Mus musculus. BF T00221; E2F; Quality: 6; Species: human, Homo sapiens. BF T00232; E2F+E4; Quality: 6; Species: human, Homo sapiens. BF T01543; E2F-1; Quality: 6; Species: mouse, Mus musculus. BF T00722; pRb; Quality: 2; Species: human, Homo sapiens. BF T01423; pRb; Quality: 3; Species: mouse, Mus musculus. BF T01489; RBP60; Quality: 6; Species: human, Homo sapiens. BF T01490; RBP60; Quality: 2; Species: mouse, Mus musculus. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0003; 3T3 SO 0069; F9 SO 0070; F9(EC) SO 0100; HeLa SO 0135; L SO 0306; rec(human-E.coli) SO 0393; HeLa Ad5 SO 0426; F9+RA+cAMP SO 0427; F9+RA+cAMP + Ad SO 0428; F9(EC) + Ad XX MM DNase I footprinting MM exonuclease digests MM gel retardation MM methylation protection MM methylation interference XX CC gel shift with DRTF gives rise to 3 complexes, one of them being sensitive CC towards dephosphorylation [2]; complex DRTF1a contains Rb and increases CC upon F9 differentiation, whereas DRTF1b and -c decrease [3]; DRTFa (200 CC kDa, sedim.) at 8.5 d.p.c. changes to DRTF1a' (165 kDa, sedim.) at CC 14.5-17.5 d.p.c. in liver; brain: a, testis, thymus: a' remain XX DR TRANSPATH: XN000005753 DR TRANSPATH: XN000005754 DR TRANSPATH: XN000005755 DR TRANSPATH: XN000007293 DR TRANSPATH: XN000007339 DR TRANSPATH: XN000007352 DR TRANSPATH: XN000008876 DR TRANSPATH: XN000008877 DR EMBL: J01917; HACG (27145:27163). DR EPD: EP07154; AD2_E3. DR EPD: EP07153; AD2_V33P. DR TRANSCOMPEL: C00193. XX RN [1] RX MEDLINE; 93024374. RA Ray S. K., Arroyo M., Bagchi S., Raychaudhuri P. RT Identification of a 60-Kilodalton Rb-binding protein, RBP60, that allows RT the Rb-E2F complex to bind DNA RL Mol. Cell. Biol. 12:4327-4333 (1992). RN [2] RX MEDLINE; 91141520. RA Shivji M. K. K., La Thangue N. B. RT Multicomponent differentiation-regulated transcription factors in F9 RT embryonal carcinoma stem cells RL Mol. Cell. Biol. 11:1686-1695 (1991). RN [3] RX MEDLINE; 92037545. RA Partridge J. F., La Thangue N. B. RT A developmentally regulated and tissue-dependent transcription factor RT complexes with the retinoblastoma gene product RL EMBO J. 10:3819-3827 (1991). RN [4] RX MEDLINE; 90175381. RA Boeuf H., Reimund B., Jansen-Duerr P., Kedinger C. RT Differential activation of the E2F transcription factor by the adenovirus RT EIa and EIV products in F9 cells RL Proc. Natl. Acad. Sci. USA 87:1782-1786 (1990). RN [5] RX MEDLINE; 90175426. RA Neill S. D., Hemstrom C., Virtanen A., Nevins J. R. RT An adenovirus E4 gene product trans-activates E2 transcription and RT stimulates stable E2F binding through a direct association with E2F RL Proc. Natl. Acad. Sci. USA 87:2008-2012 (1990). RN [6] RX MEDLINE; 90291982. RA Mudryj M., Hiebert S. W., Nevins J. R. RT A role for the adenovirus inducible E2F transcription factor in a RT proliferation dependent signal transduction pathway RL EMBO J. 9:2179-2184 (1990). RN [7] RX MEDLINE; 90059930. RA Jansen-Duerr P., Boeuf H., Kedinger C. RT Cooperative binding of two E2F molecules to an E1a-responsive promoter is RT triggered by the adenovirus E1a, but not by a cellular E1a-like activity RL EMBO J. 8:3365-3370 (1989). RN [8] RX MEDLINE; 90108666. RA Huang M.-M., Hering P. RT The adenovirus early 4 open reading frame 6/7 protein regulates the DNA RT binding activity of the cellular transcription factor, E2F, through a RT direct complex RL Genes Dev. 3:1699-1710 (1989). RN [9] RX MEDLINE; 89378737. RA Hardy S., Engel D. A., Shenk T. RT An adenovirus early region 4 gene product is required for induction of the RT infection-specific form of cellular E2F activity RL Genes Dev. 3:1062-1074 (1989). RN [10] RX MEDLINE; 89197969. RA Loeken M. R., Brady J. RT The Adenovirus EIIA Enhancer RL J. Biol. Chem. 264:6572-6579 (1989). RN [11] RX MEDLINE; 89219051. RA Yee A. S., Raychaudhuri P., Jakoi L., Nevins J. R. RT The Adenovirus-Inducible Factor E2F Stimulates Transcription after Specific RT DNA Binding RL Mol. Cell. Biol. 9:578-585 (1989). RN [12] RX MEDLINE; 90066460. RA Hardy S., Shenk T. RT E2F from Adenovirus-Infected Cells Binds Cooperatively to DNA Containing RT Two Properly Oriented and Spaced Recognition Sites RL Mol. Cell. Biol. 9:4495-4506 (1989). RN [13] RX MEDLINE; 89264470. RA Hiebert S. W., Lipp M., Nevins J. R. RT E1A-dependent trans-activation of the human MYC promoter is mediated by the RT E2F factor RL Proc. Natl. Acad. Sci. USA 86:3594-3598 (1989). RN [14] RX MEDLINE; 88004418. RA Yee A. S., Reichel R., Kovesdi I., Nevins J. R. RT Promoter interaction of the E1A-inducible factor E2F and its potential role RT in the formation of a multi-component complex RL EMBO J. 6:2061-2068 (1987). RN [15] RX MEDLINE; 87317605. RA SivaRaman L., Thimmappaya B. RT Two promoter-specific host factors interact with adjacent sequences in an RT EIA-inducible adenovirus promoter RL Proc. Natl. Acad. Sci. USA 84:6112-6116 (1987). XX // AC R00327 XX ID AD$E2AE1_13 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SQ GCGCCCTT. XX EL element A XX SF -59 ST -36 XX BF T00246; EIIaE-A; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007374 DR EMBL: J01917; HACG (27132:27139). DR EPD: EP07154; AD2_E3. DR EPD: EP07153; AD2_V33P. XX RN [1] RX MEDLINE; 88065522. RA Jalinot P., Devaux B., Kedinger C. RT The Abundance and In Vitro DNA Binding of Three Cellular Proteins RT Interacting with the Adenovirus EIIa Early Promoter Are Not Modified by the RT EIa Gene Products RL Mol. Cell. Biol. 7:3806-3817 (1987). XX // AC R00328 XX ID AD$E2AE1_14 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SF -50 ST -32 XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM genomic in situ DNAse I footprinting XX RN [1] RX MEDLINE; 88142851. RA Devaux B., Albrecht G., Kedinger C. RT Identical Genomic Footprints of the Adenovirus EIIa Promoter Are Detected RT before and after EIa Induction RL Mol. Cell. Biol. 7:4560-4563 (1987). XX // AC R00329 XX ID AD$E2AE1_15 XX DT 20.06.1990 (created); ewi. DT 17.10.2001 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SQ gaaaggGCGCGAAActa. XX SF -49 ST -35 XX BF T00221; E2F; Quality: 6; Species: human, Homo sapiens. BF T00232; E2F+E4; Quality: 6; Species: human, Homo sapiens. BF T01543; E2F-1; Quality: 6; Species: mouse, Mus musculus. BF T01277; spE2F; Quality: 6; Species: fission yeast, Schizosaccharomyces BF pombe. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0003; 3T3 SO 0069; F9 SO 0070; F9(EC) SO 0100; HeLa SO 0393; HeLa Ad5 SO 0426; F9+RA+cAMP SO 0427; F9+RA+cAMP + Ad SO 0428; F9(EC) + Ad SO 0601; S.pombe XX MM DNase I footprinting MM exonuclease digests MM gel retardation MM methylation protection MM methylation interference XX CC reverse orientation in AD2! XX DR TRANSPATH: XN000005755 DR TRANSPATH: XN000007339 DR TRANSPATH: XN000007352 DR EMBL: J01917; HACG (-27141:-27125). DR TRANSCOMPEL: C00193. XX RN [1] RX MEDLINE; 93388615. RA Malhotra P., Manohar C. F., Swaminathan S., Toyama R., Dhar R., Reichel R., RA Thimmapaya B. RT E2F site activates transcription in fission yeast Schizosaccharomyces pombe RT and binds to a 30-kDa transcription factor RL J. Biol. Chem. 268:20392-20401 (1993). RN [2] RX MEDLINE; 90175381. RA Boeuf H., Reimund B., Jansen-Duerr P., Kedinger C. RT Differential activation of the E2F transcription factor by the adenovirus RT EIa and EIV products in F9 cells RL Proc. Natl. Acad. Sci. USA 87:1782-1786 (1990). RN [3] RX MEDLINE; 90175426. RA Neill S. D., Hemstrom C., Virtanen A., Nevins J. R. RT An adenovirus E4 gene product trans-activates E2 transcription and RT stimulates stable E2F binding through a direct association with E2F RL Proc. Natl. Acad. Sci. USA 87:2008-2012 (1990). RN [4] RX MEDLINE; 90291982. RA Mudryj M., Hiebert S. W., Nevins J. R. RT A role for the adenovirus inducible E2F transcription factor in a RT proliferation dependent signal transduction pathway RL EMBO J. 9:2179-2184 (1990). RN [5] RX MEDLINE; 90059930. RA Jansen-Duerr P., Boeuf H., Kedinger C. RT Cooperative binding of two E2F molecules to an E1a-responsive promoter is RT triggered by the adenovirus E1a, but not by a cellular E1a-like activity RL EMBO J. 8:3365-3370 (1989). RN [6] RX MEDLINE; 90108666. RA Huang M.-M., Hering P. RT The adenovirus early 4 open reading frame 6/7 protein regulates the DNA RT binding activity of the cellular transcription factor, E2F, through a RT direct complex RL Genes Dev. 3:1699-1710 (1989). RN [7] RX MEDLINE; 89378737. RA Hardy S., Engel D. A., Shenk T. RT An adenovirus early region 4 gene product is required for induction of the RT infection-specific form of cellular E2F activity RL Genes Dev. 3:1062-1074 (1989). RN [8] RX MEDLINE; 89197969. RA Loeken M. R., Brady J. RT The Adenovirus EIIA Enhancer RL J. Biol. Chem. 264:6572-6579 (1989). RN [9] RX MEDLINE; 89219051. RA Yee A. S., Raychaudhuri P., Jakoi L., Nevins J. R. RT The Adenovirus-Inducible Factor E2F Stimulates Transcription after Specific RT DNA Binding RL Mol. Cell. Biol. 9:578-585 (1989). RN [10] RX MEDLINE; 90066460. RA Hardy S., Shenk T. RT E2F from Adenovirus-Infected Cells Binds Cooperatively to DNA Containing RT Two Properly Oriented and Spaced Recognition Sites RL Mol. Cell. Biol. 9:4495-4506 (1989). RN [11] RX MEDLINE; 89264470. RA Hiebert S. W., Lipp M., Nevins J. R. RT E1A-dependent trans-activation of the human MYC promoter is mediated by the RT E2F factor RL Proc. Natl. Acad. Sci. USA 86:3594-3598 (1989). RN [12] RX MEDLINE; 88004418. RA Yee A. S., Reichel R., Kovesdi I., Nevins J. R. RT Promoter interaction of the E1A-inducible factor E2F and its potential role RT in the formation of a multi-component complex RL EMBO J. 6:2061-2068 (1987). XX // AC R00330 XX ID AD$E2AE1_16 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SQ GCGCGAAA. XX SF -48 ST -33 XX BF T00221; E2F; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007339 DR EMBL: X02996; AD5001 (-219:-212). XX RN [1] RX MEDLINE; 87317605. RA SivaRaman L., Thimmappaya B. RT Two promoter-specific host factors interact with adjacent sequences in an RT EIA-inducible adenovirus promoter RL Proc. Natl. Acad. Sci. USA 84:6112-6116 (1987). XX // AC R00331 XX ID AD$E2AE1_17 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SQ ACTCTTAAGG. XX SF -36 ST -19 XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting XX DR EMBL: J01917; HACG (27113:27122). DR EPD: EP07154; AD2_E3. DR EPD: EP07153; AD2_V33P. XX RN [1] RX MEDLINE; 87146375. RA Boeuf H., Zajchowski D., Tamura T., Hauss C., Kedinger C. RT Specific cellular proteins bind to critical promoter sequences if the RT adenovirus early EIIa promoter RL Nucleic Acids Res. 15:509-527 (1987). XX // AC R00332 XX ID AD$E2AE1_18 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE EIIaE1 (E2-early promoter); Gene: G000005. XX SQ CTGACTCTTAAGGAC. XX EL element T1 XX SF -36 ST -4 XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR EMBL: J01917; HACG (27110:27124). DR EPD: EP07154; AD2_E3. DR EPD: EP07153; AD2_V33P. XX RN [1] RX MEDLINE; 88065522. RA Jalinot P., Devaux B., Kedinger C. RT The Abundance and In Vitro DNA Binding of Three Cellular Proteins RT Interacting with the Adenovirus EIIa Early Promoter Are Not Modified by the RT EIa Gene Products RL Mol. Cell. Biol. 7:3806-3817 (1987). XX // AC R00333 XX ID AD2$E2L_01 XX DT 20.06.1990 (created); ewi. DT 06.03.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E2L (E2-late promoter); Gene: G000006. XX SQ GGGGGGATTGGG. XX SF -250 ST -228 XX BF T00170; CRF; Quality: 6; Species: human, Homo sapiens. BF T00323; G6 factor; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007255 DR TRANSPATH: XN000007464 DR EMBL: J01917; HACG (-26194:-26183). XX RN [1] RX MEDLINE; 88040407. RA Goding C. R., Temperley S. M., Fisher F. RT Multiple transcription factors interact with the adenovirus-2 EII-late RT promoter: evidence for a new CCAAT recognition factor RL Nucleic Acids Res. 15:7761-7780 (1987). XX // AC R00334 XX ID AD2$E2L_02 XX DT 20.06.1990 (created); ewi. DT 06.03.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E2L (E2-late promoter); Gene: G000006. XX SQ AACCCCCC. XX SF -213 ST -186 XX BF T00323; G6 factor; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007464 DR EMBL: J01917; HACG (-26150:-26143). XX RN [1] RX MEDLINE; 88040407. RA Goding C. R., Temperley S. M., Fisher F. RT Multiple transcription factors interact with the adenovirus-2 EII-late RT promoter: evidence for a new CCAAT recognition factor RL Nucleic Acids Res. 15:7761-7780 (1987). XX // AC R00335 XX ID AD2$E2L_03 XX DT 20.06.1990 (created); ewi. DT 06.03.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E2L (E2-late promoter); Gene: G000006. XX SQ ATTGG. XX SF -155 ST -128 XX BF T00170; CRF; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000007255 DR EMBL: J01917; HACG (-26094:-26090). XX RN [1] RX MEDLINE; 88040407. RA Goding C. R., Temperley S. M., Fisher F. RT Multiple transcription factors interact with the adenovirus-2 EII-late RT promoter: evidence for a new CCAAT recognition factor RL Nucleic Acids Res. 15:7761-7780 (1987). XX // AC R00336 XX ID AD2$E2L_04 XX DT 20.06.1990 (created); ewi. DT 06.03.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E2L (E2-late promoter); Gene: G000006. XX SQ TGACgcA. XX SF -125 ST -97 XX BF T00878; USF2; Quality: 6; Species: human, Homo sapiens. BF T02115; USF2; Quality: 6; Species: rat, Rattus norvegicus. BF T02377; USF2b; Quality: 6; Species: human, Homo sapiens. XX MX M00726; V$USF2_Q6 XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM methylation interference XX DR TRANSPATH: XN000008289 DR TRANSPATH: XN000009164 DR TRANSPATH: XN000009244 DR EMBL: J01917; HACG (-26067:-26061). XX RN [1] RX MEDLINE; 88040407. RA Goding C. R., Temperley S. M., Fisher F. RT Multiple transcription factors interact with the adenovirus-2 EII-late RT promoter: evidence for a new CCAAT recognition factor RL Nucleic Acids Res. 15:7761-7780 (1987). XX // AC R00337 XX ID AD2$E2L_05 XX DT 20.06.1990 (created); ewi. DT 06.03.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E2L (E2-late promoter); Gene: G000006. XX SQ CGGGCGGGATTGG. XX SF -90 ST -65 XX BF T00170; CRF; Quality: 6; Species: human, Homo sapiens. BF T00759; Sp1; Quality: 4; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM gel shift competition MM methylation interference XX DR TRANSPATH: XN000007255 DR EMBL: J01917; HACG (-26039:-26027). XX RN [1] RX MEDLINE; 88040407. RA Goding C. R., Temperley S. M., Fisher F. RT Multiple transcription factors interact with the adenovirus-2 EII-late RT promoter: evidence for a new CCAAT recognition factor RL Nucleic Acids Res. 15:7761-7780 (1987). XX // AC R00338 XX ID AD2$E2L_06 XX DT 20.06.1990 (created); ewi. DT 06.03.2000 (updated); vma. CO Copyright (C), Biobase GmbH. XX TY D XX DE E2L (E2-late promoter); Gene: G000006. XX SQ TGGGCGTGGT. XX SF -56 ST -36 XX BF T00759; Sp1; Quality: 4; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM gel shift competition MM methylation interference XX DR EMBL: J01917; HACG (-26005:-25996). XX RN [1] RX MEDLINE; 88040407. RA Goding C. R., Temperley S. M., Fisher F. RT Multiple transcription factors interact with the adenovirus-2 EII-late RT promoter: evidence for a new CCAAT recognition factor RL Nucleic Acids Res. 15:7761-7780 (1987). XX // AC R00339 XX ID AD$E3_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE E3 (early gene 3); Gene: G000007. XX SF -179 ST -160 XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX MM DNase I footprinting XX RN [1] RX MEDLINE; 89127211. RA Kornuc M., Altman R., Harrich D., Garcia J., Chao J., Kayne P., Gaynor R. RT Adenovirus transcriptional regulatory regions are conserved in mammalian RT cells and Saccharomycer cerevisiae RL Mol. Cell. Biol. 8:3717-3725 (1988). XX // AC R00340 XX ID AD$E3_02 XX DT 20.06.1990 (created); ewi. DT 28.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E3 (early gene 3); Gene: G000007. XX SQ tagTTGGCCCGCTGCCCTggtgta. XX SF -179 ST -156 XX BF T00174; CTF; Quality: 6; Species: human, Homo sapiens. BF T00536; NF-1; Quality: 6; Species: clawed frog, Xenopus. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0095; H9 SO 0100; HeLa SO 0116; HuT-78 SO 0394; oocytes XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007266 DR TRANSPATH: XN000007725 DR EMBL: J01917; HACG (27430:27453). DR EPD: EP07154; AD2_E3. DR EPD: EP07153; AD2_V33P. XX RN [1] RX MEDLINE; 91092268. RA Williams J. L., Garcia J., Harrich D., Pearson L., Wu F., Gaynor R. RT Lymphoid specific gene expression of the adenovirus early region 3 promoter RT is mediated by NF-kappaB binding motifs RL EMBO J. 9:4435-4442 (1990). RN [2] RX MEDLINE; 90078230. RA Merino A., Buckbinder L., Mermelstein F. H., Reinberg D. RT Phosphorylation of cellular proteins regulates their binding to the cAMP RT response element RL J. Biol. Chem. 264:21266-21276 (1989). RN [3] RX MEDLINE; 89315196. RA Richter J. D. RT In vivo photocrosslinking reveals that transcription factor binding to the RT mammalian ATF recognition sequence is required for E1A-induced RT transactivation in injected Xenopus laevis oocytes RL Nucleic Acids Res. 17:4503-4516 (1989). RN [4] RX MEDLINE; 88040461. RA Garcia J., Wu F., Gaynor R. RT Upstream regulatory regions required to stabilize binding to the TATA RT sequence in an adenovirus early promoter RL Nucleic Acids Res. 15:8367-8385 (1987). XX // AC R00341 XX ID AD$E3_03 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E3 (early gene 3); Gene: G000007. XX SQ gaagttcAGATGACTaactca. XX SF -103 ST -83 XX BF T00029; AP-1; Quality: 4; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0095; H9 SO 0100; HeLa SO 0394; oocytes XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000005756 DR EMBL: J01917; HACG (27506:27526). DR EPD: EP07154; AD2_E3. DR EPD: EP07153; AD2_V33P. XX RN [1] RX MEDLINE; 91092268. RA Williams J. L., Garcia J., Harrich D., Pearson L., Wu F., Gaynor R. RT Lymphoid specific gene expression of the adenovirus early region 3 promoter RT is mediated by NF-kappaB binding motifs RL EMBO J. 9:4435-4442 (1990). RN [2] RX MEDLINE; 90076146. RA Buckbinder L., Miralles V. J., Reinberg D. RT TPA can overcome the requirement for EIa and together can act RT synergistically in stimulating expression of the adenovirus EIII promoter RL EMBO J. 8:4239-4250 (1989). RN [3] RX MEDLINE; 90078230. RA Merino A., Buckbinder L., Mermelstein F. H., Reinberg D. RT Phosphorylation of cellular proteins regulates their binding to the cAMP RT response element RL J. Biol. Chem. 264:21266-21276 (1989). RN [4] RX MEDLINE; 89315196. RA Richter J. D. RT In vivo photocrosslinking reveals that transcription factor binding to the RT mammalian ATF recognition sequence is required for E1A-induced RT transactivation in injected Xenopus laevis oocytes RL Nucleic Acids Res. 17:4503-4516 (1989). RN [5] RX MEDLINE; 88040461. RA Garcia J., Wu F., Gaynor R. RT Upstream regulatory regions required to stabilize binding to the TATA RT sequence in an adenovirus early promoter RL Nucleic Acids Res. 15:8367-8385 (1987). XX // AC R00342 XX ID AD$E3_04 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE E3 (early gene 3); Gene: G000007. XX SF -103 ST -74 XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX MM DNase I footprinting XX RN [1] RX MEDLINE; 89127211. RA Kornuc M., Altman R., Harrich D., Garcia J., Chao J., Kayne P., Gaynor R. RT Adenovirus transcriptional regulatory regions are conserved in mammalian RT cells and Saccharomycer cerevisiae RL Mol. Cell. Biol. 8:3717-3725 (1988). XX // AC R00343 XX ID AD$E3_05 XX DT 20.06.1990 (created); ewi. DT 12.05.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E3 (early gene 3); Gene: G000007. XX SQ ggcggcTTTCGTCAcagggtg. XX SF -70 ST -42 XX BF T00029; AP-1; Quality: 3; Species: human, Homo sapiens. BF T00051; ATF; Quality: 2; Species: human, Homo sapiens. BF T00968; ATF-1; Quality: 6; Species: human, Homo sapiens. BF T00054; ATF-like; Quality: 4; Species: clawed frog, Xenopus. BF T00167; CRE-BP1; Quality: 6; Species: human, Homo sapiens. BF T00163; CREB; Quality: 1; Species: human, Homo sapiens. BF T00223; E4F1; Quality: 6; Species: human, Homo sapiens. XX MX M00691; V$ATF1_Q6 MX M00694; V$E4F1_Q6 XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0046; CA-77 SO 0095; H9 SO 0100; HeLa SO 0298; yeast SO 0323; rec(human-ret lys) SO 0394; oocytes XX MM affinity chromatography MM DNase I footprinting MM direct gel shift MM supershift (antibody binding) MM gel shift competition XX DR TRANSPATH: XN000005756 DR TRANSPATH: XN000005757 DR TRANSPATH: XN000005758 DR TRANSPATH: XN000007101 DR TRANSPATH: XN000007102 DR TRANSPATH: XN000007343 DR EMBL: J01917; HACG (27542:27562). DR EPD: EP07154; AD2_E3. DR EPD: EP07153; AD2_V33P. XX RN [1] RX MEDLINE; 91342628. RA Jones C., Lee K. A. W. RT E1A-mediated activation of the adenovirus E4 promoter can occur RT independently of the cellular transcription factor E4F RL Mol. Cell. Biol. 11:4297-4305 (1991). RN [2] RX MEDLINE; 91092268. RA Williams J. L., Garcia J., Harrich D., Pearson L., Wu F., Gaynor R. RT Lymphoid specific gene expression of the adenovirus early region 3 promoter RT is mediated by NF-kappaB binding motifs RL EMBO J. 9:4435-4442 (1990). RN [3] RX MEDLINE; 90076146. RA Buckbinder L., Miralles V. J., Reinberg D. RT TPA can overcome the requirement for EIa and together can act RT synergistically in stimulating expression of the adenovirus EIII promoter RL EMBO J. 8:4239-4250 (1989). RN [4] RX MEDLINE; 90078230. RA Merino A., Buckbinder L., Mermelstein F. H., Reinberg D. RT Phosphorylation of cellular proteins regulates their binding to the cAMP RT response element RL J. Biol. Chem. 264:21266-21276 (1989). RN [5] RX MEDLINE; 89315196. RA Richter J. D. RT In vivo photocrosslinking reveals that transcription factor binding to the RT mammalian ATF recognition sequence is required for E1A-induced RT transactivation in injected Xenopus laevis oocytes RL Nucleic Acids Res. 17:4503-4516 (1989). RN [6] RX MEDLINE; 88261270. RA Andrisani O. M., Pot D. A., Zhu Z., Dixon J. E. RT Three Sequence-Specific DNA-Protein Complexes Are Formed with the Same RT Promoter Element Essential for Expression of the Rat Somatostatin Gene RL Mol. Cell. Biol. 8:1947-1956 (1988). RN [7] RX MEDLINE; 88247984. RA Hardy S., Shenk T. RT Adenoviral control regions activated by E1A and the cAMP responsive element RT bind to the same factor RL Proc. Natl. Acad. Sci. USA 85:4171-4175 (1988). RN [8] RX MEDLINE; 88040461. RA Garcia J., Wu F., Gaynor R. RT Upstream regulatory regions required to stabilize binding to the TATA RT sequence in an adenovirus early promoter RL Nucleic Acids Res. 15:8367-8385 (1987). XX // AC R00344 XX ID AD$E3_06 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E3 (early gene 3); Gene: G000007. XX SQ gggcagggTATAActcacctga. XX SF -37 ST -16 XX BF T00820; TFIID; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0095; H9 SO 0100; HeLa SO 0394; oocytes XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000008147 DR EMBL: J01917; HACG (27572:27593). DR EPD: EP07154; AD2_E3. DR EPD: EP07153; AD2_V33P. XX RN [1] RX MEDLINE; 91092268. RA Williams J. L., Garcia J., Harrich D., Pearson L., Wu F., Gaynor R. RT Lymphoid specific gene expression of the adenovirus early region 3 promoter RT is mediated by NF-kappaB binding motifs RL EMBO J. 9:4435-4442 (1990). RN [2] RX MEDLINE; 89315196. RA Richter J. D. RT In vivo photocrosslinking reveals that transcription factor binding to the RT mammalian ATF recognition sequence is required for E1A-induced RT transactivation in injected Xenopus laevis oocytes RL Nucleic Acids Res. 17:4503-4516 (1989). RN [3] RX MEDLINE; 88040461. RA Garcia J., Wu F., Gaynor R. RT Upstream regulatory regions required to stabilize binding to the TATA RT sequence in an adenovirus early promoter RL Nucleic Acids Res. 15:8367-8385 (1987). XX // AC R00345 XX ID AD$E3_07 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E3 (early gene 3); Gene: G000007. XX SQ TAACTCA. XX SF -35 XX BF T00029; AP-1; Quality: 1; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM affinity chromatography MM DNase I footprinting XX DR TRANSPATH: XN000005756 DR EMBL: J01917; HACG (27582:27588). DR EPD: EP07154; AD2_E3. DR EPD: EP07153; AD2_V33P. XX RN [1] RX MEDLINE; 90076146. RA Buckbinder L., Miralles V. J., Reinberg D. RT TPA can overcome the requirement for EIa and together can act RT synergistically in stimulating expression of the adenovirus EIII promoter RL EMBO J. 8:4239-4250 (1989). XX // AC R00346 XX ID AD$E3_08 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE E3 (early gene 3); Gene: G000007. XX SF -37 ST -6 XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX MM DNase I footprinting XX RN [1] RX MEDLINE; 89127211. RA Kornuc M., Altman R., Harrich D., Garcia J., Chao J., Kayne P., Gaynor R. RT Adenovirus transcriptional regulatory regions are conserved in mammalian RT cells and Saccharomycer cerevisiae RL Mol. Cell. Biol. 8:3717-3725 (1988). XX // AC R00347 XX ID AD$E4_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SF -306 ST -281 XX BF T00539; NF-1; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation MM gel shift competition XX RN [1] RX MEDLINE; 88216605. RA Watanabe H., Imai T., Sharp P. A., Handa H. RT Identification of two transcription factors that bind to specific elements RT in the promoter of the adenovirus early-region 4 RL Mol. Cell. Biol. 8:1290-1300 (1988). XX // AC R00348 XX ID AD$E4_02 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ GTGACGT. XX SF -267 ST -247 XX BF T00223; E4F1; Quality: 6; Species: human, Homo sapiens. XX MX M00694; V$E4F1_Q6 XX OS adenovirus OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007342 DR EMBL: J01917; HACG (-35876:-35870). XX RN [1] RX MEDLINE; 88216605. RA Watanabe H., Imai T., Sharp P. A., Handa H. RT Identification of two transcription factors that bind to specific elements RT in the promoter of the adenovirus early-region 4 RL Mol. Cell. Biol. 8:1290-1300 (1988). XX // AC R00349 XX ID AD$E4_03 XX DT 20.06.1990 (created); ewi. DT 23.01.1996 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ GTGACGT. XX SF -239 ST -215 XX BF T00167; CRE-BP1; Quality: 2; Species: human, Homo sapiens. BF T00223; E4F1; Quality: 6; Species: human, Homo sapiens. XX MX M00694; V$E4F1_Q6 XX OS adenovirus OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa SO 0306; rec(human-E.coli) XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000005759 DR TRANSPATH: XN000007342 DR EMBL: J01917; HACG (-35844:-35838). XX RN [1] RX MEDLINE; 90005408. RA Maekawa T., Sakura H., Kanei-Ishii C., Sudo T., Yoshimura T., Fujisawa RA J.-I., Yoshida M., Ishii S. RT Leucine zipper structure of the protein CRE-BP1 binding to the cyclic AMP RT response element in brain RL EMBO J. 8:2023-2328 (1989). RN [2] RX MEDLINE; 88216605. RA Watanabe H., Imai T., Sharp P. A., Handa H. RT Identification of two transcription factors that bind to specific elements RT in the promoter of the adenovirus early-region 4 RL Mol. Cell. Biol. 8:1290-1300 (1988). XX // AC R00350 XX ID AD$E4_04 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SF -200 XX BF T00051; ATF; Quality: 2; Species: human, Homo sapiens. XX OS adenovirus OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa SO 0679; rec(human-) XX MM DNase I footprinting XX DR TRANSPATH: XN000007089 XX RN [1] RX MEDLINE; 88327847. RA Horikoshi M., Hai T., Lin Y.-S., Green M. R., Roeder R. G. RT Transcription factor ATF interacts with the TATA factor to facilitate RT establishment of a preinitiation complex RL Cell 54:1033-1042 (1988). XX // AC R00351 XX ID AD$E4_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ GTGACGT. XX SF -174 ST -150 XX BF T00223; E4F1; Quality: 6; Species: human, Homo sapiens. XX MX M00694; V$E4F1_Q6 XX OS adenovirus OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa SO 0679; rec(human-) XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007342 DR EMBL: J01917; HACG (-35778:-35772). XX RN [1] RX MEDLINE; 88216605. RA Watanabe H., Imai T., Sharp P. A., Handa H. RT Identification of two transcription factors that bind to specific elements RT in the promoter of the adenovirus early-region 4 RL Mol. Cell. Biol. 8:1290-1300 (1988). XX // AC R00352 XX ID AD$E4_06 XX DT 20.06.1990 (created); ewi. DT 06.03.1998 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ TGACGTAAC. XX SF -169 ST -162 XX BF T00051; ATF; Quality: 2; Species: human, Homo sapiens. BF T00050; atf1; Quality: 2; Species: fission yeast, Schizosaccharomyces pombe. BF T00133; c-Jun; Quality: 2; Species: human, Homo sapiens. BF T00167; CRE-BP1; Quality: 2; Species: human, Homo sapiens. BF T00166; deltaCREB; Quality: 2; Species: human, Homo sapiens. BF T01428; E4BP4; Quality: 2; Species: human, Homo sapiens. XX OS adenovirus OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa SO 0323; rec(human-ret lys) SO 0327; rec(S.pombe-ret lys) SO 0601; S.pombe XX MM DNase I footprinting MM direct gel shift MM supershift (antibody binding) MM gel shift competition MM methylation interference XX CC conflict: AD5004 is tTacgtaac, AD2 is tgacgtaTc XX DR TRANSPATH: XN000005759 DR TRANSPATH: XN000005760 DR TRANSPATH: XN000007089 DR TRANSPATH: XN000007254 DR TRANSPATH: XN000008844 DR EMBL: X02998; AD5004 (-1419:-1411). DR EMBL: J01917; HACG (-35777:-35769). XX RN [1] RX MEDLINE; 96134918. RA Takeda T., Toda T., Kominami K., Kohnosu A., Yanagida M., Jones N. RT Schizosaccharomyces pombe atf1+ encodes a transcription factor required for RT sexual development and entry into stationary phase RL EMBO J. 14:6193-6208 (1995). RN [2] RX MEDLINE; 94248047. RA Benbrook D. M., Jones N. C. RT Different binding specificities and transactivation of variant CRE's by RT CREB complexes RL Nucleic Acids Res. 22:1463-1469 (1994). RN [3] RX MEDLINE; 92318924. RA Cowell I. G., Skinner A., Hurst H. C. RT Transcriptional repression by a novel member of the bZIP family of RT transcription factors RL Mol. Cell. Biol. 12:3070-3077 (1992). RN [4] RX MEDLINE; 90377203. RA Rooney R. J., Raychaudhuri P., Nevins J. R. RT E4F and ATF, two transcription factors that recognize the same site, can be RT distinguished both physically and functionally: a role for E4F in E1A trans RT activation RL Mol. Cell. Biol. 10:5138-5149 (1990). RN [5] RX MEDLINE; 90191714. RA Benbrook D. M., Jones N. C. RT Heterodimer formation between CREB and JUN proteins RL Oncogene 5:295-302 (1990). RN [6] RX MEDLINE; 88327847. RA Horikoshi M., Hai T., Lin Y.-S., Green M. R., Roeder R. G. RT Transcription factor ATF interacts with the TATA factor to facilitate RT establishment of a preinitiation complex RL Cell 54:1033-1042 (1988). XX // AC R00353 XX ID AD$E4_07 XX DT 20.06.1990 (created); ewi. DT 20.04.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ TGACGTAT. XX SF -173 ST -145 XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM direct gel shift XX DR EMBL: J01917; HACG (-35777:-35770). XX RN [1] RX MEDLINE; 88247984. RA Hardy S., Shenk T. RT Adenoviral control regions activated by E1A and the cAMP responsive element RT bind to the same factor RL Proc. Natl. Acad. Sci. USA 85:4171-4175 (1988). XX // AC R00354 XX ID AD$E4_08 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ ACGTaACGT. SQ GTGACGA. XX SF -172 ST -135 XX BF T00223; E4F1; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting XX DR TRANSPATH: XN000007342 DR EMBL: X02998; AD5004 (-1417:-1409). DR EMBL: X02998; AD5004 (-1396:-1390). XX RN [1] RA Kang T., Martins T., Sandowski I. RT Wild type GAL4 binds cooperatively th the GAL1-10 UASG in vitro RL J. Biol. Chem. 268:9629-9635 (1993). RN [2] RX MEDLINE; 87275829. RA Lee K. A. W., Green M. R. RT A cellular transcription factor E4F1 interacts with an E1A-inducible RT enhancer and mediates constitutive enhancer function in vitro RL EMBO J. 6:1345-1353 (1987). XX // AC R00355 XX ID AD$E4_09 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ TGACGTAAC. XX SF -170 ST -163 XX BF T00222; E4F; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 2 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0393; HeLa Ad5 XX MM DNase I footprinting MM gel retardation MM methylation interference XX CC conflict: corresponding AD2 sequence is tgacgtaTc XX DR TRANSPATH: XN000007341 DR EMBL: X02998; AD5004 (1295:1303). XX RN [1] RA Kang T., Martins T., Sandowski I. RT Wild type GAL4 binds cooperatively th the GAL1-10 UASG in vitro RL J. Biol. Chem. 268:9629-9635 (1993). RN [2] RX MEDLINE; 90377203. RA Rooney R. J., Raychaudhuri P., Nevins J. R. RT E4F and ATF, two transcription factors that recognize the same site, can be RT distinguished both physically and functionally: a role for E4F in E1A trans RT activation RL Mol. Cell. Biol. 10:5138-5149 (1990). RN [3] RX MEDLINE; 89306600. RA Raychaudhuri P., Bagchi S., Nevins J. R. RT DNA-binding activity of the adenovirus-induced E4F transcription factor is RT regulated by phosphorylation RL Genes Dev. 3:620-627 (1989). RN [4] RX MEDLINE; 88166652. RA Raychaudhuri P., Rooney R., Nevins J. R. RT Identification of an E1A-inducible cellular factor that interacts with RT regulatory sequences within the adenovirus E4 promoter RL EMBO J. 6:4073-4081 (1987). XX // AC R00356 XX ID AD$E4_10 XX DT 20.06.1990 (created); ewi. DT 07.12.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ TTACGTCA. XX SF -167 ST -138 XX BF T00167; CRE-BP1; Quality: 2; Species: human, Homo sapiens. BF T01017; CRE-BP2; Quality: 6; Species: mouse, Mus musculus. BF T00163; CREB; Quality: 2; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0306; rec(human-E.coli) SO 0676; rec(mouse-lambda-E.coli) XX MM DNase I footprinting MM gel retardation XX CC conflict: AD5004 is TTACGTAA XX DR TRANSPATH: XN000005759 DR TRANSPATH: XN000005761 DR TRANSPATH: XN000005762 DR EMBL: X02998; AD5004 (-1302:-1295). XX RN [1] RX MEDLINE; 90205841. RA Ivashkiv L. B., Liou H.-C., Kara C. J., Lamph W. W., Verma I. M., Glimcher RA L. H. RT mXBP/CRE-BP2 and c-Jun form a complex which binds to the cyclic AMP, but RT not to the 12-O-tetradecanoylphorbol-13-acetate, response element RL Mol. Cell. Biol. 10:1609-1621 (1990). RN [2] RX MEDLINE; 90005408. RA Maekawa T., Sakura H., Kanei-Ishii C., Sudo T., Yoshimura T., Fujisawa RA J.-I., Yoshida M., Ishii S. RT Leucine zipper structure of the protein CRE-BP1 binding to the cyclic AMP RT response element in brain RL EMBO J. 8:2023-2328 (1989). RN [3] RX MEDLINE; 88247984. RA Hardy S., Shenk T. RT Adenoviral control regions activated by E1A and the cAMP responsive element RT bind to the same factor RL Proc. Natl. Acad. Sci. USA 85:4171-4175 (1988). XX // AC R00357 XX ID AD$E4_11 XX DT 20.06.1990 (created); ewi. DT 23.01.1996 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ AAAACGGAAGTGACG. XX SF -152 ST -132 XX BF T00268; GABP; Quality: 6; Species: human, Homo sapiens. BF T01390; GABP-alpha; Quality: 6; Species: human, Homo sapiens. BF T01391; GABP-beta1; Quality: 6; Species: human, Homo sapiens. BF T01392; GABP-beta2; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa SO 0306; rec(human-E.coli) XX MM DNase I footprinting MM direct gel shift XX DR TRANSPATH: XN000007410 DR EMBL: X02998; AD5004 (-1405:-1391). XX RN [1] RX MEDLINE; 94185646. RA Sawada J.-I., Goto M., Sawa C., Watanabe H., Handa H. RT Transcriptional activation through the tetrameric complex formation of RT E4TF1 subunits RL EMBO J. 13:1396-1402 (1994). RN [2] RX MEDLINE; 93180783. RA Watanabe H., Sawada J.-I., Yano K.-I., Yamaguchi K., Goto M., Handa H. RT cDNA cloning of transcription factor E4TF1 subunits with Ets and Notch RT motifs RL Mol. Cell. Biol. 13:1385-1391 (1993). RN [3] RX MEDLINE; 90183984. RA Watanabe H., Wada T., Handa H. RT Transcription factor E4TF1 contains two subunits with different functions RL EMBO J. 9:841-847 (1990). RN [4] RX MEDLINE; 88216605. RA Watanabe H., Imai T., Sharp P. A., Handa H. RT Identification of two transcription factors that bind to specific elements RT in the promoter of the adenovirus early-region 4 RL Mol. Cell. Biol. 8:1290-1300 (1988). XX // AC R00358 XX ID AD$E4_12 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SF -118 ST -94 XX BF T00269; E4TF2; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0679; rec(human-) XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007412 XX RN [1] RX MEDLINE; 88216605. RA Watanabe H., Imai T., Sharp P. A., Handa H. RT Identification of two transcription factors that bind to specific elements RT in the promoter of the adenovirus early-region 4 RL Mol. Cell. Biol. 8:1290-1300 (1988). XX // AC R00359 XX ID AD$E4_13 XX DT 20.06.1990 (created); ewi. DT 09.07.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SF -100 XX BF T00051; ATF; Quality: 2; Species: human, Homo sapiens. BF T00846; TREB-1; Quality: 2; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0679; rec(human-) XX MM DNase I footprinting XX DR TRANSPATH: XN000007089 DR TRANSPATH: XN000008192 XX RN [1] RX MEDLINE; 89261803. RA Tan T.-H., Horikoshi M., Roeder R. G. RT Purification and Characterization of Multiple Nuclear Factors That Bind to RT the TAX-Inducible Enhancer within the Human T-Cell Leukemia Virus Long RT Terminal Repeat RL Mol. Cell. Biol. 9:1733-1745 (1989). RN [2] RX MEDLINE; 88327847. RA Horikoshi M., Hai T., Lin Y.-S., Green M. R., Roeder R. G. RT Transcription factor ATF interacts with the TATA factor to facilitate RT establishment of a preinitiation complex RL Cell 54:1033-1042 (1988). XX // AC R00360 XX ID AD$E4_14 XX DT 20.06.1990 (created); ewi. DT 09.07.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SF -80 XX BF T00051; ATF; Quality: 2; Species: human, Homo sapiens. BF T00820; TFIID; Quality: 6; Species: human, Homo sapiens. BF T00846; TREB-1; Quality: 2; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0679; rec(human-) XX MM DNase I footprinting XX DR TRANSPATH: XN000007089 DR TRANSPATH: XN000008148 DR TRANSPATH: XN000008192 XX RN [1] RX MEDLINE; 89261803. RA Tan T.-H., Horikoshi M., Roeder R. G. RT Purification and Characterization of Multiple Nuclear Factors That Bind to RT the TAX-Inducible Enhancer within the Human T-Cell Leukemia Virus Long RT Terminal Repeat RL Mol. Cell. Biol. 9:1733-1745 (1989). RN [2] RX MEDLINE; 88327847. RA Horikoshi M., Hai T., Lin Y.-S., Green M. R., Roeder R. G. RT Transcription factor ATF interacts with the TATA factor to facilitate RT establishment of a preinitiation complex RL Cell 54:1033-1042 (1988). XX // AC R00361 XX ID AD$E4_15 XX DT 20.06.1990 (created); ewi. DT 28.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ AAAAAATGACGTAACGGTTAAAGTCCACAAAAAACA. XX SF -74 ST -39 XX BF T01018; CAP; Quality: 6; Species: E.coli, Escherichia coli. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0507; E.coli XX MM DNase I footprinting XX DR TRANSPATH: XN000008437 DR EMBL: X02998; AD5004 (1289:1324). XX RN [1] RX MEDLINE; 89365161. RA Lin Y.-S., Green M. R. RT Similarities between prokaryotic and eukaryotic cyclic AMP-responsive RT promoter elements RL Nature 340:656-659 (1989). XX // AC R00362 XX ID AD$E4_16 XX DT 20.06.1990 (created); ewi. DT 07.12.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ ACGTCA. XX SF -58 ST -40 XX BF T00049; ATF; Quality: 4; Species: yeast, Saccharomyces cerevisiae. BF T00051; ATF; Quality: 4; Species: human, Homo sapiens. BF T00050; atf1; Quality: 4; Species: fission yeast, Schizosaccharomyces pombe. BF T01095; ATF3; Quality: 6; Species: rat, Rattus norvegicus. BF T00132; c-Jun; Quality: 6; Species: rat, Rattus norvegicus. BF T00167; CRE-BP1; Quality: 6; Species: human, Homo sapiens. BF T00163; CREB; Quality: 6; Species: human, Homo sapiens. BF T00164; CREB; Quality: 6; Species: rat, Rattus norvegicus. BF T00166; deltaCREB; Quality: 6; Species: human, Homo sapiens. BF T00942; EivF; Quality: 6; Species: human, Homo sapiens. BF T00846; TREB-1; Quality: 6; Species: human, Homo sapiens. XX MX M00513; V$ATF3_Q6 XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0070; F9(EC) SO 0100; HeLa SO 0298; yeast SO 0320; rec(rat-ret lys) SO 0353; rec(human-lambda) SO 0426; F9+RA+cAMP SO 0601; S.pombe XX MM DNase I footprinting MM direct gel shift MM gel shift competition MM methylation protection MM methylation interference XX CC different binding activities in undifferentiated and differentiated F9 CC cells [5]; rel. affinity of CRE-BP1 comp. to MHC Aalpha-el.=1.20 [3] XX DR TRANSPATH: XN000005759 DR TRANSPATH: XN000005761 DR TRANSPATH: XN000005763 DR TRANSPATH: XN000005764 DR TRANSPATH: XN000007089 DR TRANSPATH: XN000007254 DR TRANSPATH: XN000008192 DR TRANSPATH: XN000008355 DR TRANSPATH: XN000008508 XX RN [1] RX MEDLINE; 91219401. RA Hsu J. C., Laz T., Mohn K. L., Taub R. RT Identification of LRF-1, a leucine-zipper protein that is rapidly and RT highly induced in regenerating liver RL Proc. Natl. Acad. Sci. USA 88:3511-3515 (1991). RN [2] RX MEDLINE; 91061725. RA Hurst H. C., Masson M., Jones N. C., Lee K. A. W. RT The cellular transcription factor CREB corresponds to activating RT transcription factor 47 (ATF-47) and forms complexes with a group of RT polypeptides related to ATF-43 RL Mol. Cell. Biol. 10:6192-6203 (1990). RN [3] RX MEDLINE; 90205810. RA Kara C. J., Liou H.-C., Ivashkiv L. B., Glimcher L. H. RT A cDNA for a human cyclic AMP response element-binding protein which is RT distinct from CREB and expressed preferentially in brain RL Mol. Cell. Biol. 10:1347-1357 (1990). RN [4] RX MEDLINE; 90377203. RA Rooney R. J., Raychaudhuri P., Nevins J. R. RT E4F and ATF, two transcription factors that recognize the same site, can be RT distinguished both physically and functionally: a role for E4F in E1A trans RT activation RL Mol. Cell. Biol. 10:5138-5149 (1990). RN [5] RX MEDLINE; 91208099. RA Tassios P. T., La Thangue N. B. RT A multiplicity of differentiation-regulated ATF site-binding activities in RT embryonal carcinoma cells with distinct sequence and promoter specificities RL New Biol. 2:1123-1134 (1990). RN [6] RX MEDLINE; 89098860. RA Lin Y.-S., Green M. R. RT Identification and purification of a Saccharomyces cerevisiae protein with RT the DNA binding specificity of mammalian activating transcription factor RL Proc. Natl. Acad. Sci. USA 86:109-113 (1989). RN [7] RX MEDLINE; 90078230. RA Merino A., Buckbinder L., Mermelstein F. H., Reinberg D. RT Phosphorylation of cellular proteins regulates their binding to the cAMP RT response element RL J. Biol. Chem. 264:21266-21276 (1989). RN [8] RX MEDLINE; 89278150. RA Miralles V. J., Cortes P., Stone N., Reinberg D. RT The adenovirus inverted terminal repeat functions as an enhancer in a RT cell-free system RL J. Biol. Chem. 264:10763-10772 (1989). RN [9] RX MEDLINE; 89261803. RA Tan T.-H., Horikoshi M., Roeder R. G. RT Purification and Characterization of Multiple Nuclear Factors That Bind to RT the TAX-Inducible Enhancer within the Human T-Cell Leukemia Virus Long RT Terminal Repeat RL Mol. Cell. Biol. 9:1733-1745 (1989). RN [10] RX MEDLINE; 89365161. RA Lin Y.-S., Green M. R. RT Similarities between prokaryotic and eukaryotic cyclic AMP-responsive RT promoter elements RL Nature 340:656-659 (1989). RN [11] RX MEDLINE; 89184591. RA Jones R. H., Jones N. C. RT Mammalian cAMP-responsive element can activate transcription in yeast and RT binds a yeast factor(s) that resembles the mammalian transcription factor RT ATF RL Proc. Natl. Acad. Sci. USA 86:2176-2180 (1989). RN [12] RX MEDLINE; 88327847. RA Horikoshi M., Hai T., Lin Y.-S., Green M. R., Roeder R. G. RT Transcription factor ATF interacts with the TATA factor to facilitate RT establishment of a preinitiation complex RL Cell 54:1033-1042 (1988). RN [13] RX MEDLINE; 88217908. RA Lin Y.-S., Green M. R. RT Interaction of a common cellular transcription factor, ATF, with regulatory RT elements in both E1a- and cyclic AMP-inducible promoters RL Proc. Natl. Acad. Sci. USA 85:3396-3400 (1988). XX // AC R00363 XX ID AD$E4_17 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ CGTtACGt. XX SF -56 ST -39 XX BF T00223; E4F1; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa SO 0298; yeast SO 0601; S.pombe XX MM DNase I footprinting XX DR TRANSPATH: XN000007342 DR EMBL: X02998; AD5004 (-1304:-1297). XX RN [1] RX MEDLINE; 87275829. RA Lee K. A. W., Green M. R. RT A cellular transcription factor E4F1 interacts with an E1A-inducible RT enhancer and mediates constitutive enhancer function in vitro RL EMBO J. 6:1345-1353 (1987). XX // AC R00364 XX ID AD$E4_18 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ ACGTCAT. XX SF -54 ST -33 XX BF T00223; E4F1; Quality: 6; Species: human, Homo sapiens. XX MX M00694; V$E4F1_Q6 XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa SO 0298; yeast SO 0601; S.pombe XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007342 DR EMBL: X02998; AD5004 (-1300:-1294). XX RN [1] RX MEDLINE; 88216605. RA Watanabe H., Imai T., Sharp P. A., Handa H. RT Identification of two transcription factors that bind to specific elements RT in the promoter of the adenovirus early-region 4 RL Mol. Cell. Biol. 8:1290-1300 (1988). XX // AC R00365 XX ID AD$E4_19 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ GTTACGTC. XX SF -53 ST -46 XX BF T00222; E4F; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0298; yeast SO 0393; HeLa Ad5 SO 0601; S.pombe XX MM DNase I footprinting MM direct gel shift MM methylation interference XX DR TRANSPATH: XN000007341 DR EMBL: X02998; AD5004 (-1303:-1296). XX RN [1] RX MEDLINE; 91220647. RA Nicholas J., Nevins J. R. RT Distinct DNA targets for trans-activation by HTLV-1 tax and adenovirus E1A RL Virology 182:156-167 (1991). RN [2] RX MEDLINE; 90377203. RA Rooney R. J., Raychaudhuri P., Nevins J. R. RT E4F and ATF, two transcription factors that recognize the same site, can be RT distinguished both physically and functionally: a role for E4F in E1A trans RT activation RL Mol. Cell. Biol. 10:5138-5149 (1990). RN [3] RX MEDLINE; 89306600. RA Raychaudhuri P., Bagchi S., Nevins J. R. RT DNA-binding activity of the adenovirus-induced E4F transcription factor is RT regulated by phosphorylation RL Genes Dev. 3:620-627 (1989). RN [4] RX MEDLINE; 88166652. RA Raychaudhuri P., Rooney R., Nevins J. R. RT Identification of an E1A-inducible cellular factor that interacts with RT regulatory sequences within the adenovirus E4 promoter RL EMBO J. 6:4073-4081 (1987). XX // AC R00366 XX ID AD$E4_20 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ TGACGTAA. XX SF -45 XX BF T00163; CREB; Quality: 2; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa SO 0298; yeast SO 0601; S.pombe XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000005761 DR EMBL: X02998; AD5004 (1295:1302). XX RN [1] RX MEDLINE; 88247984. RA Hardy S., Shenk T. RT Adenoviral control regions activated by E1A and the cAMP responsive element RT bind to the same factor RL Proc. Natl. Acad. Sci. USA 85:4171-4175 (1988). XX // AC R00367 XX ID AD$E4_21 XX DT 20.06.1990 (created); ewi. DT 07.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SF -30 XX BF T00795; TBP; Quality: 6; Species: fission yeast, Schizosaccharomyces pombe. BF T00798; TBP; Quality: 6; Species: yeast, Saccharomyces cerevisiae. BF T00820; TFIID; Quality: 6; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa SO 0298; yeast SO 0601; S.pombe XX MM DNase I footprinting XX DR TRANSPATH: XN000008148 XX RN [1] RX MEDLINE; 88327847. RA Horikoshi M., Hai T., Lin Y.-S., Green M. R., Roeder R. G. RT Transcription factor ATF interacts with the TATA factor to facilitate RT establishment of a preinitiation complex RL Cell 54:1033-1042 (1988). XX // AC R00368 XX ID AD$E4_22 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE E4 (early gene 4); Gene: G000008. XX SQ TGAC. XX SF 7 ST 13 XX BF T00029; AP-1; Quality: 3; Species: human, Homo sapiens. XX OS adenovirus type 5 OC viridae; ds-DNA nonenveloped viruses; adenoviridae XX SO 0100; HeLa XX MM DNase I footprinting MM direct gel shift MM supershift (antibody binding) MM gel shift competition XX DR TRANSPATH: XN000005765 XX RN [1] RX MEDLINE; 90078230. RA Merino A., Buckbinder L., Mermelstein F. H., Reinberg D. RT Phosphorylation of cellular proteins regulates their binding to the cAMP RT response element RL J. Biol. Chem. 264:21266-21276 (1989). XX // AC R00369 XX ID TO$E8_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); rge. CO Copyright (C), Biobase GmbH. XX TY D XX DE E8; Gene: G000839. XX SF -1088 ST -682 XX OS tomato, Lycopersicon esculentum OC eukaryota; viridiplantae; embryobionta; magnoliophyta; magnoliopsida; OC asteridae; solanes; solanaceae XX MM gel retardation XX RN [1] RX MEDLINE; 89091070. RA Deikman J., Fischer R. L. RT Interaction of a DNA binding factor with the 5'-flanking region of an RT ethylene-responsive fruit ripening gene from tomato RL EMBO J. 11:3315-3320 (1988). XX // AC R00370 XX ID TO$E8_02 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); rge. CO Copyright (C), Biobase GmbH. XX TY D XX DE E8; Gene: G000839. XX SF -863 ST -432 XX OS tomato, Lycopersicon esculentum OC eukaryota; viridiplantae; embryobionta; magnoliophyta; magnoliopsida; OC asteridae; solanes; solanaceae XX MM gel retardation XX RN [1] RX MEDLINE; 89091070. RA Deikman J., Fischer R. L. RT Interaction of a DNA binding factor with the 5'-flanking region of an RT ethylene-responsive fruit ripening gene from tomato RL EMBO J. 11:3315-3320 (1988). XX // AC R00371 XX ID TO$E8_03 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); rge. CO Copyright (C), Biobase GmbH. XX TY D XX DE E8; Gene: G000839. XX SF -631 ST -349 XX OS tomato, Lycopersicon esculentum OC eukaryota; viridiplantae; embryobionta; magnoliophyta; magnoliopsida; OC asteridae; solanes; solanaceae XX MM gel retardation XX RN [1] RX MEDLINE; 89091070. RA Deikman J., Fischer R. L. RT Interaction of a DNA binding factor with the 5'-flanking region of an RT ethylene-responsive fruit ripening gene from tomato RL EMBO J. 11:3315-3320 (1988). XX // AC R00372 XX ID Y$TEF1_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE TEF1 (translation elongation factor-1alpha TEF1 gene); Gene: G000911. XX SQ AACACCCAAGCACAG. XX S1 ATG SF -338 ST -309 XX BF T00715; RAP1; Quality: 2; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM gel retardation MM methylation protection XX DR EMBL: M10992; SCEF1AB (148:162). XX RN [1] RX MEDLINE; 90354467. RA Vignais M.-L., Huet J., Buhler J.-M., Sentenac A. RT Contacts between the factor TUF and RPG sequences RL J. Biol. Chem. 256:14669-14674 (1990). RN [2] RX MEDLINE; 86135993. RA Huet J., Cottrelle P., Cool M., Vignais M.-L., Thiele D., Marck C., Buhler RA J.-M., Sentenac A., Fromageot P. RT A general upstream binding factor for genes of the yeast translational RT apparatus RL EMBO J. 4:3539-3547 (1985). XX // AC R00373 XX ID Y$TEF2_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE TEF2 (translation elongation factor-1alpha TEF2 gene); Gene: G000910. XX SQ ACCTCCGTACATTCatgttGCACCCACACATTTatACACCCAGACCGCG. XX EL 3 RPG boxes XX S1 ATG SF -442 ST -405 XX BF T00715; RAP1; Quality: 2; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM gel retardation MM methylation protection XX DR EMBL: X78993; SCRACII (57441:57489). XX RN [1] RX MEDLINE; 91184617. RA Kurtz S., Shore D. RT RAP1 protein activates and silences transcription of mating-type genes in RT yeast RL Genes Dev. 5:616-628 (1991). RN [2] RX MEDLINE; 90354467. RA Vignais M.-L., Huet J., Buhler J.-M., Sentenac A. RT Contacts between the factor TUF and RPG sequences RL J. Biol. Chem. 256:14669-14674 (1990). RN [3] RX MEDLINE; 86135993. RA Huet J., Cottrelle P., Cool M., Vignais M.-L., Thiele D., Marck C., Buhler RA J.-M., Sentenac A., Fromageot P. RT A general upstream binding factor for genes of the yeast translational RT apparatus RL EMBO J. 4:3539-3547 (1985). XX // AC R00374 XX ID HS$EGFR_01 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX SQ GCGCCGCCCCACTC. XX S1 ATG SF -457 ST -444 XX BF T00759; Sp1; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 SO 0130; KB-3-1 XX MM DNase I footprinting MM exonuclease III XX DR EMBL: M38425; HSEGFR01 (653:666). DR EMBL: X06370; HSEGFR1 (641:654). DR EMBL: M11234; HSEGFRG (9:22). DR EPD: EP15043; HS_EGFR_1. DR EPD: EP15044; HS_EGFR_2. XX RN [1] RX MEDLINE; 88186885. RA Johnson A. C., Ishii S., Jinno Y., Pastan I., Merlino G. T. RT Epidermal Growth Factor Receptor Gene Promoter RL J. Biol. Chem. 263:5693-5699 (1988). XX // AC R00375 XX ID HS$EGFR_02 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX SQ ACCGCTGTCCACCGCC. XX S1 ATG SF -417 ST -402 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 SO 0130; KB-3-1 XX MM exonuclease III XX DR EMBL: M11234; HSEGFRG (48:63). DR EPD: EP15043; HS_EGFR_1. DR EPD: EP15044; HS_EGFR_2. XX RN [1] RX MEDLINE; 88186885. RA Johnson A. C., Ishii S., Jinno Y., Pastan I., Merlino G. T. RT Epidermal Growth Factor Receptor Gene Promoter RL J. Biol. Chem. 263:5693-5699 (1988). XX // AC R00376 XX ID HS$EGFR_03 XX DT 20.06.1990 (created); ewi. DT 12.12.1994 (updated); thh; ewi; mgo. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX SQ TTCTCCTCCCTCCTCctcgcatTCTCCTCCTCCTC. XX S1 ATG SF -370 ST -340 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 XX MM DNase I footprinting XX DR EMBL: M38425; HSEGFR01 (743:777). DR EMBL: X06370; HSEGFR1 (731:765). XX RN [1] RX MEDLINE; 89039842. RA Johnson A. C., Jinno Y., Merlino G. T. RT Modulation of Epidermal Growth Factor Receptor Proto-Oncogene Transcription RT by a promoter Site Sensitive to S1 Nuclease RL Mol. Cell. Biol. 8:4174-4184 (1988). XX // AC R00377 XX ID HS$EGFR_04 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX SQ ATCCCTCCTC. XX S1 ATG SF -323 ST -314 XX BF T00759; Sp1; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 SO 0130; KB-3-1 XX MM DNase I footprinting XX DR EMBL: M38425; HSEGFR01 (789:798). DR EMBL: X06370; HSEGFR1 (777:786). DR EMBL: M11234; HSEGFRG (141:150). DR EPD: EP15043; HS_EGFR_1. DR EPD: EP15044; HS_EGFR_2. XX RN [1] RX MEDLINE; 88186885. RA Johnson A. C., Ishii S., Jinno Y., Pastan I., Merlino G. T. RT Epidermal Growth Factor Receptor Gene Promoter RL J. Biol. Chem. 263:5693-5699 (1988). RN [2] RX MEDLINE; 89039842. RA Johnson A. C., Jinno Y., Merlino G. T. RT Modulation of Epidermal Growth Factor Receptor Proto-Oncogene Transcription RT by a promoter Site Sensitive to S1 Nuclease RL Mol. Cell. Biol. 8:4174-4184 (1988). XX // AC R00378 XX ID HS$EGFR_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX SQ GTCCCTCCTCCTCCCGCCC. XX S1 ATG SF -304 ST -286 XX BF T00759; Sp1; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 SO 0130; KB-3-1 XX MM DNase I footprinting MM exonuclease III XX DR EMBL: M38425; HSEGFR01 (808:826). DR EMBL: X06370; HSEGFR1 (796:814). DR EMBL: M11234; HSEGFRG (160:178). DR EPD: EP15043; HS_EGFR_1. DR EPD: EP15044; HS_EGFR_2. XX RN [1] RX MEDLINE; 88186885. RA Johnson A. C., Ishii S., Jinno Y., Pastan I., Merlino G. T. RT Epidermal Growth Factor Receptor Gene Promoter RL J. Biol. Chem. 263:5693-5699 (1988). RN [2] RX MEDLINE; 89039842. RA Johnson A. C., Jinno Y., Merlino G. T. RT Modulation of Epidermal Growth Factor Receptor Proto-Oncogene Transcription RT by a promoter Site Sensitive to S1 Nuclease RL Mol. Cell. Biol. 8:4174-4184 (1988). XX // AC R00379 XX ID HS$EGFR_06 XX DT 20.06.1990 (created); ewi. DT 28.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX SQ GCCCTGCCTCCCC. XX SF -293 ST -281 XX BF T00270; ETF; Quality: 6; Species: human, Homo sapiens. XX MX M00695; V$ETF_Q6 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 XX MM DNase I footprinting XX CC conflict: all EMBL sequences end on..CCCG. XX DR TRANSPATH: XN000007415 DR EMBL: M38425; HSEGFR01 (823:835). DR EMBL: X06370; HSEGFR1 (811:823). DR EMBL: M11234; HSEGFRG (175:187). DR EMBL: J03206; HSEGFRO (12:24). DR EPD: EP15043; HS_EGFR_1. DR EPD: EP15044; HS_EGFR_2. XX RN [1] RX MEDLINE; 89359391. RA Kageyama R., Merlino G. T., Pastan I. RT Nuclear Factor ETF Specifically Stimulates Transcription from Promoters RT without a TATA Box RL J. Biol. Chem. 264:15508-15514 (1989). XX // AC R00380 XX ID HS$EGFR_07 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX SQ CAGCCCCCGGCGCAGC. XX SF -248 ST -233 XX BF T00270; ETF; Quality: 6; Species: human, Homo sapiens. XX MX M00695; V$ETF_Q6 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007415 DR EMBL: M38425; HSEGFR01 (867:882). DR EMBL: X06370; HSEGFR1 (855:870). DR EMBL: M11234; HSEGFRG (219:234). DR EMBL: J03206; HSEGFRO (56:71). DR EPD: EP15043; HS_EGFR_1. DR EPD: EP15044; HS_EGFR_2. XX RN [1] RX MEDLINE; 89359391. RA Kageyama R., Merlino G. T., Pastan I. RT Nuclear Factor ETF Specifically Stimulates Transcription from Promoters RT without a TATA Box RL J. Biol. Chem. 264:15508-15514 (1989). RN [2] RX MEDLINE; 88276890. RA Kageyama I., Merlino R., Pastan G.T. RT A transcription factor active on the epidermal growth factor receptor gene RL Proc. Natl. Acad. Sci. USA 85:5016-5020 (1988). XX // AC R00381 XX ID HS$EGFR_08 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX SQ TCCGCCCCCCGCACGG. XX S1 ATG SF -215 ST -200 XX BF T00759; Sp1; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 SO 0130; KB-3-1 XX MM DNase I footprinting MM exonuclease III XX DR EMBL: M11234; HSEGFRG (249:264). DR EMBL: J03206; HSEGFRO (86:101). DR EPD: EP15043; HS_EGFR_1. DR EPD: EP15044; HS_EGFR_2. XX RN [1] RX MEDLINE; 88186885. RA Johnson A. C., Ishii S., Jinno Y., Pastan I., Merlino G. T. RT Epidermal Growth Factor Receptor Gene Promoter RL J. Biol. Chem. 263:5693-5699 (1988). RN [2] RX MEDLINE; 89039842. RA Johnson A. C., Jinno Y., Merlino G. T. RT Modulation of Epidermal Growth Factor Receptor Proto-Oncogene Transcription RT by a promoter Site Sensitive to S1 Nuclease RL Mol. Cell. Biol. 8:4174-4184 (1988). XX // AC R00382 XX ID HS$EGFR_09 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX SQ GCCCCCCGCAC. XX SF -214 ST -204 XX BF T00270; ETF; Quality: 6; Species: human, Homo sapiens. XX MX M00695; V$ETF_Q6 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 XX MM DNase I footprinting XX DR TRANSPATH: XN000007415 DR EMBL: M11234; HSEGFRG (252:262). DR EMBL: J03206; HSEGFRO (89:99). DR EPD: EP15043; HS_EGFR_1. DR EPD: EP15044; HS_EGFR_2. XX RN [1] RX MEDLINE; 89359391. RA Kageyama R., Merlino G. T., Pastan I. RT Nuclear Factor ETF Specifically Stimulates Transcription from Promoters RT without a TATA Box RL J. Biol. Chem. 264:15508-15514 (1989). XX // AC R00383 XX ID HS$EGFR_10 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX SQ CGCCGAGGCGGCCGGAGTCCCGAGC. XX S1 ATG SF -185 ST -161 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 SO 0130; KB-3-1 XX MM exonuclease III XX DR EMBL: M38425; HSEGFR01 (929:953). DR EMBL: X06370; HSEGFR1 (917:941). DR EMBL: M11234; HSEGFRG (280:304). DR EMBL: J03206; HSEGFRO (116:140). DR EPD: EP15043; HS_EGFR_1. DR EPD: EP15044; HS_EGFR_2. XX RN [1] RX MEDLINE; 88186885. RA Johnson A. C., Ishii S., Jinno Y., Pastan I., Merlino G. T. RT Epidermal Growth Factor Receptor Gene Promoter RL J. Biol. Chem. 263:5693-5699 (1988). XX // AC R00384 XX ID HS$EGFR_11 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX SQ CCAGACCGGACGAC. XX S1 ATG SF -139 ST -126 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 SO 0130; KB-3-1 XX MM exonuclease III XX DR EMBL: M38425; HSEGFR01 (975:988). DR EMBL: X06370; HSEGFR1 (963:976). DR EMBL: J03206; HSEGFRO (162:175). XX RN [1] RX MEDLINE; 88186885. RA Johnson A. C., Ishii S., Jinno Y., Pastan I., Merlino G. T. RT Epidermal Growth Factor Receptor Gene Promoter RL J. Biol. Chem. 263:5693-5699 (1988). XX // AC R00385 XX ID HS$EGFR_12 XX DT 20.06.1990 (created); ewi. DT 09.11.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX SQ tccgcccGAGTCCCcgcctcgccgcc. XX S1 ATG SF -109 ST -84 XX BF T00733; RPF1; Quality: 6; Species: human, Homo sapiens. BF T00759; Sp1; Quality: 1; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 SO 0100; HeLa SO 0130; KB-3-1 XX MM affinity chromatography MM DNase I footprinting MM functional analysis MM exonuclease III MM direct gel shift MM gel shift competition MM methylation interference MM primer extension footprint MM UV-crosslinking XX CC activating element; Sp1: purified factor; activation by Sp1 is repressed in CC response to T3R, RXR, T3, 9-cis RA due to competitive binding XX DR TRANSPATH: XN000008029 DR EMBL: M38425; HSEGFR01 (1005:1030). DR EMBL: X06370; HSEGFR1 (993:1018). DR EMBL: M11234; HSEGFRG (356:381). DR EMBL: J03206; HSEGFRO (192:217). DR EPD: EP15044; HS_EGFR_2. XX RN [1] RX MEDLINE; 93340220. RA Xu J., Thompson K. L., Shephard L. B., Hudson L. G., Gill G. N. RT T3 receptor suppression of Sp1-dependent transcription from the epidermal RT growth factor receptor promoter via overlapping DNA-binding sites RL J. Biol. Chem. 268:16065-16073 (1993). RN [2] RX MEDLINE; 91017540. RA Hudson L. G., Thompson K. L., Xu J., Gill G. N. RT Identification and characterization of a regulated promoter element in the RT epidermal growth factor receptor gene RL Proc. Natl. Acad. Sci. USA 87:7536-7540 (1990). RN [3] RX MEDLINE; 88186885. RA Johnson A. C., Ishii S., Jinno Y., Pastan I., Merlino G. T. RT Epidermal Growth Factor Receptor Gene Promoter RL J. Biol. Chem. 263:5693-5699 (1988). RN [4] RX MEDLINE; 89039842. RA Johnson A. C., Jinno Y., Merlino G. T. RT Modulation of Epidermal Growth Factor Receptor Proto-Oncogene Transcription RT by a promoter Site Sensitive to S1 Nuclease RL Mol. Cell. Biol. 8:4174-4184 (1988). XX // AC R00386 XX ID HS$EGFR_13 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX SQ TGATCGGGAGAGCCGGAGCGA. XX S1 ATG SF -39 ST -19 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 SO 0130; KB-3-1 XX MM exonuclease III XX DR EMBL: M38425; HSEGFR01 (1075:1095). DR EMBL: X06370; HSEGFR1 (1063:1083). DR EMBL: M11234; HSEGFRG (427:447). DR EMBL: J03206; HSEGFRO (262:282). XX RN [1] RX MEDLINE; 88186885. RA Johnson A. C., Ishii S., Jinno Y., Pastan I., Merlino G. T. RT Epidermal Growth Factor Receptor Gene Promoter RL J. Biol. Chem. 263:5693-5699 (1988). XX // AC R00387 XX ID HS$EGFR_14 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX RE 1st intron, downstream enhancer XX SQ TTACAATATtgcCAAAT. XX EL windows 1-3 XX S1 SstI site within 1st intron SF 27 ST 43 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX DR EMBL: M22310; HSEGFE2 (27:43). DR EMBL: M38425; HSEGFR01 (2927:2943). XX RN [1] RX MEDLINE; 89174588. RA Maekawa T., Imamoto F., Merlino G. T., Pastan I., Ishii S. RT Cooperative Function of Two Separate Enhancers of the Human Epidermal RT Growth Factor Receptor Proto-oncogene RL J. Biol. Chem. 264:5488-5494 (1989). XX // AC R00388 XX ID HS$EGFR_15 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX RE 1st intron, downstream enhancer XX SQ TCAAT. XX EL window 4 XX S1 SstI site within 1st intron SF 74 ST 79 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX CC conflict: HSEGFR01(2974:) is TCCAAT XX DR EMBL: M22310; HSEGFE2 (74:78). DR EMBL: M38425; HSEGFR01 (2974:2978). XX RN [1] RX MEDLINE; 89174588. RA Maekawa T., Imamoto F., Merlino G. T., Pastan I., Ishii S. RT Cooperative Function of Two Separate Enhancers of the Human Epidermal RT Growth Factor Receptor Proto-oncogene RL J. Biol. Chem. 264:5488-5494 (1989). XX // AC R00389 XX ID HS$EGFR_16 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX RE 1st intron, downstream enhancer XX SQ TCCGCT. XX EL window 5 XX S1 SstI site within 1st intron SF 89 ST 94 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX DR EMBL: M22310; HSEGFE2 (89:94). DR EMBL: M38425; HSEGFR01 (2990:2995). XX RN [1] RX MEDLINE; 89174588. RA Maekawa T., Imamoto F., Merlino G. T., Pastan I., Ishii S. RT Cooperative Function of Two Separate Enhancers of the Human Epidermal RT Growth Factor Receptor Proto-oncogene RL J. Biol. Chem. 264:5488-5494 (1989). XX // AC R00390 XX ID HS$EGFR_17 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX RE 1st intron, downstream enhancer XX SQ GAAGgaACTGGT. XX EL windows 6, 7 XX S1 SstI site within 1st intron SF 102 ST 113 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX DR EMBL: M22310; HSEGFE2 (102:113). DR EMBL: M38425; HSEGFR01 (3003:3014). XX RN [1] RX MEDLINE; 89174588. RA Maekawa T., Imamoto F., Merlino G. T., Pastan I., Ishii S. RT Cooperative Function of Two Separate Enhancers of the Human Epidermal RT Growth Factor Receptor Proto-oncogene RL J. Biol. Chem. 264:5488-5494 (1989). XX // AC R00391 XX ID HS$EGFR_18 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX RE 1st intron, downstream enhancer XX SQ TTCTTCTC. XX EL window 8 XX S1 SstI site within 1st intron SF 122 ST 129 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX DR EMBL: M22310; HSEGFE2 (122:129). DR EMBL: M38425; HSEGFR01 (3023:3030). XX RN [1] RX MEDLINE; 89174588. RA Maekawa T., Imamoto F., Merlino G. T., Pastan I., Ishii S. RT Cooperative Function of Two Separate Enhancers of the Human Epidermal RT Growth Factor Receptor Proto-oncogene RL J. Biol. Chem. 264:5488-5494 (1989). XX // AC R00392 XX ID HS$EGFR_19 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX RE 1st intron, downstream enhancer XX SQ GCCTGC. XX EL window 9 XX S1 SstI site within 1st intron SF 136 ST 141 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX CC conflict: sequence HSEGFR01(3036:) is gAcctgc XX DR EMBL: M22310; HSEGFE2 (136:141). XX RN [1] RX MEDLINE; 89174588. RA Maekawa T., Imamoto F., Merlino G. T., Pastan I., Ishii S. RT Cooperative Function of Two Separate Enhancers of the Human Epidermal RT Growth Factor Receptor Proto-oncogene RL J. Biol. Chem. 264:5488-5494 (1989). XX // AC R00393 XX ID HS$EGFR_20 XX DT 20.06.1990 (created); ewi. DT 18.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGFR (epidermal growth factor receptor); Gene: G000251. XX RE 1st intron, downstream enhancer XX SQ TCCTGC. XX EL window 10 XX S1 SstI site within 1st intron SF 148 ST 153 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX DR EMBL: M22310; HSEGFE2 (148:153). DR EMBL: M38425; HSEGFR01 (3050:3055). XX RN [1] RX MEDLINE; 89174588. RA Maekawa T., Imamoto F., Merlino G. T., Pastan I., Ishii S. RT Cooperative Function of Two Separate Enhancers of the Human Epidermal RT Growth Factor Receptor Proto-oncogene RL J. Biol. Chem. 264:5488-5494 (1989). XX // AC R00394 XX ID HS$EGR2_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGR2 (early growth response gene 2); Gene: G000246. XX EL CArG-2 XX SF -377 ST -342 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0003; 3T3 XX MM direct gel shift XX RN [1] RX MEDLINE; 90251451. RA Rangnekar V. M., Aplin A. C., Sukhatme V. P. RT The serum and TPA responsive promoter and intron-exon structure of EGR2, a RT human early growth response gene encoding a zinc finger protein RL Nucleic Acids Res. 18:2749-2757 (1990). XX // AC R00395 XX ID HS$EGR2_02 XX DT 20.06.1990 (created); ewi. DT 29.06.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EGR2 (early growth response gene 2); Gene: G000246. XX SQ AGTCCATATATGGGCAGCGAC. XX EL CArG-1 XX SF -73 ST -53 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0003; 3T3 XX MM gel retardation XX DR EMBL: X53700; HSGEGR2 (760:780). XX RN [1] RX MEDLINE; 90251451. RA Rangnekar V. M., Aplin A. C., Sukhatme V. P. RT The serum and TPA responsive promoter and intron-exon structure of EGR2, a RT human early growth response gene encoding a zinc finger protein RL Nucleic Acids Res. 18:2749-2757 (1990). XX // AC R00396 XX ID RAT$EAI_01 XX DT 20.06.1990 (created); ewi. DT 20.04.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ELA1 (elastase I); Gene: G000738. XX SQ GGGTTAACTG. XX SF -198 ST -189 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0017; 266-6 SO 0289; rl XX MM DNase I footprinting XX DR EMBL: L00112; RNELAI1 (543:552). DR EPD: EP29005; RN_EL1. XX RN [1] RX MEDLINE; 88174734. RA Kruse F., Komro C. T., Michnoff C. H., MacDonald R. J. RT The Cell-Specific Elastase I Enhancer Comprises Two Domains RL Mol. Cell. Biol. 8:893-902 (1988). XX // AC R00397 XX ID RAT$EAI_02 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE ELA1 (elastase I); Gene: G000738. XX SQ CTGTCTTTGA. XX SF -173 ST -164 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0017; 266-6 SO 0289; rl XX MM DNase I footprinting XX DR EMBL: L00112; RNELAI1 (568:577). DR EPD: EP29005; RN_EL1. XX RN [1] RX MEDLINE; 88174734. RA Kruse F., Komro C. T., Michnoff C. H., MacDonald R. J. RT The Cell-Specific Elastase I Enhancer Comprises Two Domains RL Mol. Cell. Biol. 8:893-902 (1988). XX // AC R00398 XX ID RAT$EAI_03 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE ELA1 (elastase I); Gene: G000738. XX SQ AATATCAGATAAATGAGTTGACTT. XX SF -163 ST -141 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0017; 266-6 SO 0289; rl XX MM DNase I footprinting XX DR EMBL: L00112; RNELAI1 (577:600). DR EPD: EP29005; RN_EL1. XX RN [1] RX MEDLINE; 88174734. RA Kruse F., Komro C. T., Michnoff C. H., MacDonald R. J. RT The Cell-Specific Elastase I Enhancer Comprises Two Domains RL Mol. Cell. Biol. 8:893-902 (1988). XX // AC R00399 XX ID RAT$EAI_04 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE ELA1 (elastase I); Gene: G000738. XX SQ TCATTTGTA. XX SF -131 ST -124 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM DNase I footprinting XX DR EMBL: L00112; RNELAI1 (610:618). DR EPD: EP29005; RN_EL1. XX RN [1] RX MEDLINE; 88174734. RA Kruse F., Komro C. T., Michnoff C. H., MacDonald R. J. RT The Cell-Specific Elastase I Enhancer Comprises Two Domains RL Mol. Cell. Biol. 8:893-902 (1988). XX // AC R00400 XX ID RAT$EAI_05 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ELA1 (elastase I); Gene: G000738. XX SQ CATGTCACCTGTGCTTTTCCCTGCCTT. XX SF -114 ST -97 XX BF T00701; PTF1-beta; Quality: 6; Species: rat, Rattus norvegicus. BF T00906; XPF-1; Quality: 6; Species: dog, Canis canis. XX MX M00657; V$PTF1BETA_Q6 MX M00684; V$XPF1_Q6 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0028; AR42J SO 0410; pancreas XX MM DNase I footprinting MM methylation protection MM methylation interference XX DR TRANSPATH: XN000007941 DR TRANSPATH: XN000008309 DR EMBL: L00112; RNELAI1 (623:649). DR EPD: EP29005; RN_EL1. XX RN [1] RX MEDLINE; 92017774. RA Weinrich S. L., Meister A., Rutter W. J. RT Exocrine pancreas transcription factor 1 binds to a bipartite enhancer RT element and activates transcription of acinar genes RL Mol. Cell. Biol. 11:4985-4997 (1991). RN [2] RX MEDLINE; 91032983. RA Keller S. A., Rosenberg M. P., Johnson Th. M., Howard G., Meisler M. RT Regulation of amylase gene expression in diabetic mice is mediated by a RT cis-acting upstream element close to the pancreas-specific enhancer RL Genes Dev. 4:1316-1321 (1990). RN [3] RX MEDLINE; 89343964. RA Cockell M., Stevenson B. J., Strubin M., Hagenbuechle O., Wellauer P. K. RT Identification of a Cell-Specific DNA-Binding Activity That Interacts with RT a Transcriptional Activator of Genes Expressed in the Acinar Pancreas RL Mol. Cell. Biol. 9:2464-2476 (1989). XX // AC R00401 XX ID RAT$EAI_06 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE ELA1 (elastase I); Gene: G000738. XX SQ TGTCACCTGT. XX SF -116 ST -108 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0017; 266-6 SO 0289; rl XX MM DNase I footprinting XX DR EMBL: L00112; RNELAI1 (625:634). DR EPD: EP29005; RN_EL1. XX RN [1] RX MEDLINE; 88174734. RA Kruse F., Komro C. T., Michnoff C. H., MacDonald R. J. RT The Cell-Specific Elastase I Enhancer Comprises Two Domains RL Mol. Cell. Biol. 8:893-902 (1988). XX // AC R00402 XX ID RAT$EAI_07 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE ELA1 (elastase I); Gene: G000738. XX SQ CTACCC. XX SF -91 ST -86 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0017; 266-6 SO 0289; rl XX MM DNase I footprinting XX DR EMBL: L00112; RNELAI1 (650:655). DR EPD: EP29005; RN_EL1. XX RN [1] RX MEDLINE; 88174734. RA Kruse F., Komro C. T., Michnoff C. H., MacDonald R. J. RT The Cell-Specific Elastase I Enhancer Comprises Two Domains RL Mol. Cell. Biol. 8:893-902 (1988). XX // AC R00403 XX ID RAT$EAI_08 XX DT 20.06.1990 (created); ewi. DT 24.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ELA1 (elastase I); Gene: G000738. XX SQ ccctgccCAGCTGgc. XX SF -85 ST -58 XX BF T00906; XPF-1; Quality: 6; Species: dog, Canis canis. XX MX M00684; V$XPF1_Q6 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0017; 266-6 SO 0289; rl SO 0410; pancreas XX MM DNase I footprinting XX DR TRANSPATH: XN000008309 DR EMBL: L00112; RNELAI1 (660:674). DR EPD: EP29005; RN_EL1. XX RN [1] RX MEDLINE; 92017774. RA Weinrich S. L., Meister A., Rutter W. J. RT Exocrine pancreas transcription factor 1 binds to a bipartite enhancer RT element and activates transcription of acinar genes RL Mol. Cell. Biol. 11:4985-4997 (1991). RN [2] RX MEDLINE; 88174734. RA Kruse F., Komro C. T., Michnoff C. H., MacDonald R. J. RT The Cell-Specific Elastase I Enhancer Comprises Two Domains RL Mol. Cell. Biol. 8:893-902 (1988). XX // AC R00404 XX ID RAT$EAI_09 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE ELA1 (elastase I); Gene: G000738. XX SQ GTCAG. XX SF -57 ST -53 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0017; 266-6 SO 0289; rl XX MM DNase I footprinting XX DR EMBL: L00112; RNELAI1 (683:687). DR EPD: EP29005; RN_EL1. XX RN [1] RX MEDLINE; 88174734. RA Kruse F., Komro C. T., Michnoff C. H., MacDonald R. J. RT The Cell-Specific Elastase I Enhancer Comprises Two Domains RL Mol. Cell. Biol. 8:893-902 (1988). XX // AC R00405 XX ID RAT$EAI_10 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE ELA1 (elastase I); Gene: G000738. XX SQ TGCTGATAAGAGCC. XX SF -46 ST -33 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0017; 266-6 SO 0289; rl XX MM DNase I footprinting XX DR EMBL: L00112; RNELAI1 (694:707). DR EPD: EP29005; RN_EL1. XX RN [1] RX MEDLINE; 88174734. RA Kruse F., Komro C. T., Michnoff C. H., MacDonald R. J. RT The Cell-Specific Elastase I Enhancer Comprises Two Domains RL Mol. Cell. Biol. 8:893-902 (1988). XX // AC R00406 XX ID RAT$EAI_11 XX DT 20.06.1990 (created); ewi. DT 04.11.1994 (updated); THH; MGO. CO Copyright (C), Biobase GmbH. XX TY D XX DE ELA1 (elastase I); Gene: G000738. XX SQ TCCGCTCATGGCAAGGGGC. XX SF -19 ST -1 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0017; 266-6 SO 0289; rl XX MM DNase I footprinting XX DR EMBL: L00112; RNELAI1 (721:739). DR EPD: EP29005; RN_EL1. XX RN [1] RX MEDLINE; 88174734. RA Kruse F., Komro C. T., Michnoff C. H., MacDonald R. J. RT The Cell-Specific Elastase I Enhancer Comprises Two Domains RL Mol. Cell. Biol. 8:893-902 (1988). XX // AC R00407 XX ID MOUSE$EAII_01 XX DT 20.06.1990 (created); ewi. DT 01.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EAII (elastase II); Gene: G000506. XX EL III XX SF -156 ST -134 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0027; AR4IP SO 0028; AR42J XX MM DNase I footprinting XX RN [1] RX MEDLINE; 89343964. RA Cockell M., Stevenson B. J., Strubin M., Hagenbuechle O., Wellauer P. K. RT Identification of a Cell-Specific DNA-Binding Activity That Interacts with RT a Transcriptional Activator of Genes Expressed in the Acinar Pancreas RL Mol. Cell. Biol. 9:2464-2476 (1989). XX // AC R00408 XX ID MOUSE$EAII_02 XX DT 20.06.1990 (created); ewi. DT 01.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EAII (elastase II); Gene: G000506. XX EL II XX SF -123 ST -99 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0027; AR4IP SO 0028; AR42J XX MM DNase I footprinting XX RN [1] RX MEDLINE; 89343964. RA Cockell M., Stevenson B. J., Strubin M., Hagenbuechle O., Wellauer P. K. RT Identification of a Cell-Specific DNA-Binding Activity That Interacts with RT a Transcriptional Activator of Genes Expressed in the Acinar Pancreas RL Mol. Cell. Biol. 9:2464-2476 (1989). XX // AC R00409 XX ID MOUSE$EAII_03 XX DT 20.06.1990 (created); ewi. DT 01.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EAII (elastase II); Gene: G000506. XX SQ GACTTTGGGAAAATCTCCACCTTGCATA. XX EL I XX SF -91 ST -68 XX BF T00701; PTF1-beta; Quality: 6; Species: rat, Rattus norvegicus. XX MX M00657; V$PTF1BETA_Q6 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0028; AR42J XX MM DNase I footprinting MM gel retardation MM methylation protection MM methylation interference XX DR TRANSPATH: XN000007942 DR EMBL: X04576; MMELA2G (381:408). DR EPD: EP16055; MM_EL2. XX RN [1] RX MEDLINE; 89343964. RA Cockell M., Stevenson B. J., Strubin M., Hagenbuechle O., Wellauer P. K. RT Identification of a Cell-Specific DNA-Binding Activity That Interacts with RT a Transcriptional Activator of Genes Expressed in the Acinar Pancreas RL Mol. Cell. Biol. 9:2464-2476 (1989). XX // AC R00410 XX ID MOUSE$EAII_04 XX DT 20.06.1990 (created); ewi. DT 01.09.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE EAII (elastase II); Gene: G000506. XX EL I XX SF -83 ST -68 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0027; AR4IP XX MM DNase I footprinting XX RN [1] RX MEDLINE; 89343964. RA Cockell M., Stevenson B. J., Strubin M., Hagenbuechle O., Wellauer P. K. RT Identification of a Cell-Specific DNA-Binding Activity That Interacts with RT a Transcriptional Activator of Genes Expressed in the Acinar Pancreas RL Mol. Cell. Biol. 9:2464-2476 (1989). XX // AC R00411 XX ID DROME$EN_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE en (engrailed); Gene: G000098. XX SQ TAAATTAAATgTCAATTAAATaTCAATCAATT. XX EL k1 XX SF -926 ST -892 XX BF T00253; En; Quality: 2; Species: fruit fly, Drosophila melanogaster. BF T00272; Eve; Quality: 2; Species: fruit fly, Drosophila melanogaster. BF T00295; Ftz; Quality: 2; Species: fruit fly, Drosophila melanogaster. BF T00699; Prd; Quality: 6; Species: fruit fly, Drosophila melanogaster. BF T00917; Zen-1; Quality: 2; Species: fruit fly, Drosophila melanogaster. BF T02099; Zen-2; Quality: 2; Species: fruit fly, Drosophila melanogaster. XX MX M00629; I$EVE_Q6 MX M00696; I$EN_Q6 MX M00710; I$ZEN_Q6 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0304; rec(Drosophila-E.coli) XX MM DNase I footprinting XX DR TRANSPATH: XN000007381 DR TRANSPATH: XN000007419 DR EMBL: M29285; DMENG (1479:1510). DR Flybase: FBgn0000577; en. XX RN [1] RX MEDLINE; 88327852. RA Desplan C., Theis J., O'Farrell P. H. RT The sequence specificity of homeodomain-DNA interaction RL Cell 54:1081-1090 (1988). RN [2] RX MEDLINE; 89096828. RA Hoey T., Warrior R., Manak J., Levine M. RT DNA-Binding Activities of Drosophila melanogaster even-skipped Protein Are RT Mediated by Its Homeo Domain and Influenced by Protein Context RL Mol. Cell. Biol. 8:4598-4607 (1988). RN [3] RX MEDLINE; 88189355. RA Hoey T., Levine M. RT Divergent homeo box proteins recognize similar DNA sequences in Drosophila RL Nature 332:858-861 (1988). XX // AC R00412 XX ID DROME$EN_02 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE en (engrailed); Gene: G000098. XX SQ ACATTTAACTGGTTAATTGA. XX EL k2 XX SF -873 ST -852 XX BF T00253; En; Quality: 2; Species: fruit fly, Drosophila melanogaster. BF T00272; Eve; Quality: 2; Species: fruit fly, Drosophila melanogaster. BF T00295; Ftz; Quality: 2; Species: fruit fly, Drosophila melanogaster. BF T00456; Kr; Quality: 6; Species: fruit fly, Drosophila melanogaster. BF T00917; Zen-1; Quality: 2; Species: fruit fly, Drosophila melanogaster. BF T02099; Zen-2; Quality: 2; Species: fruit fly, Drosophila melanogaster. XX MX M00629; I$EVE_Q6 MX M00696; I$EN_Q6 MX M00710; I$ZEN_Q6 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0304; rec(Drosophila-E.coli) XX MM DNase I footprinting XX DR TRANSPATH: XN000007381 DR TRANSPATH: XN000007419 DR TRANSPATH: XN000007607 DR EMBL: M29285; DMENG (1532:1551). DR Flybase: FBgn0000577; en. XX RN [1] RX MEDLINE; 91138959. RA Zuo P., Stanojevic D., Colgan J., Han K., Levine M., Manley J. L. RT Activation and repression of transcription by the gap proteins hunchback RT and Krueppel in cultured Drosophila cells RL Genes Dev. 5:254-264 (1991). RN [2] RX MEDLINE; 88327852. RA Desplan C., Theis J., O'Farrell P. H. RT The sequence specificity of homeodomain-DNA interaction RL Cell 54:1081-1090 (1988). RN [3] RX MEDLINE; 89096828. RA Hoey T., Warrior R., Manak J., Levine M. RT DNA-Binding Activities of Drosophila melanogaster even-skipped Protein Are RT Mediated by Its Homeo Domain and Influenced by Protein Context RL Mol. Cell. Biol. 8:4598-4607 (1988). RN [4] RX MEDLINE; 88189355. RA Hoey T., Levine M. RT Divergent homeo box proteins recognize similar DNA sequences in Drosophila RL Nature 332:858-861 (1988). XX // AC R00413 XX ID DROME$EN_03 XX DT 20.06.1990 (created); ewi. DT 01.05.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE en (engrailed); Gene: G000098. XX SQ TCATTTAAAT. XX EL k3 XX SF -754 ST -729 XX BF T00272; Eve; Quality: 2; Species: fruit fly, Drosophila melanogaster. BF T00646; POU2F2 (Oct-2.1); Quality: 6; Species: human, Homo sapiens. BF T00917; Zen-1; Quality: 2; Species: fruit fly, Drosophila melanogaster. BF T02099; Zen-2; Quality: 2; Species: fruit fly, Drosophila melanogaster. XX MX M00629; I$EVE_Q6 MX M00710; I$ZEN_Q6 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0304; rec(Drosophila-E.coli) SO 0395; B cells XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007419 DR TRANSPATH: XN000007871 DR EMBL: M29285; DMENG (1651:1660). DR Flybase: FBgn0000577; en. XX RN [1] RX MEDLINE; 89003042. RA Ko H.-S., Fast P., McBride W., Staudt L. M. RT A Human Protein Specific for the Immunoglobulin Octamer DNA Motif Contains RT a Functional Homeobox Domain RL Cell 55:135-144 (1988). RN [2] RX MEDLINE; 89096828. RA Hoey T., Warrior R., Manak J., Levine M. RT DNA-Binding Activities of Drosophila melanogaster even-skipped Protein Are RT Mediated by Its Homeo Domain and Influenced by Protein Context RL Mol. Cell. Biol. 8:4598-4607 (1988). RN [3] RX MEDLINE; 88189355. RA Hoey T., Levine M. RT Divergent homeo box proteins recognize similar DNA sequences in Drosophila RL Nature 332:858-861 (1988). XX // AC R00414 XX ID DROME$EN_04 XX DT 20.06.1990 (created); ewi. DT 01.05.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE en (engrailed); Gene: G000098. XX SQ TCAATTAAAT. XX EL synthetic trimer XX BF T00253; En; Quality: 6; Species: fruit fly, Drosophila melanogaster. BF T00646; POU2F2 (Oct-2.1); Quality: 6; Species: human, Homo sapiens. XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0304; rec(Drosophila-E.coli) SO 0395; B cells XX CC sequence 3x present XX DR TRANSPATH: XN000007381 DR TRANSPATH: XN000007871 DR EMBL: M29285; DMENG (1490:1499). DR Flybase: FBgn0000577; en. XX RN [1] RX MEDLINE; 88327852. RA Desplan C., Theis J., O'Farrell P. H. RT The sequence specificity of homeodomain-DNA interaction RL Cell 54:1081-1090 (1988). RN [2] RX MEDLINE; 89070675. RA Scheidereit C., Cromlish J. A., Gerster T., Kawakami K., Balmaceda C.-G., RA Currie R. A., Roeder R. G. RT A human lymphoid-specific transcription factor that activates RT immunoglobulin genes is a homeobox protein RL Nature 336:551-557 (1988). XX // AC R00415 XX ID Y$ENO1_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ENO1 (enolase); Gene: G000912. XX SQ GCACCCAAACACCtgcaTATTTGG. XX EL UAS1 XX S1 ATG SF -473 ST -452 XX BF T00715; RAP1; Quality: 1; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast XX MM DNase I footprinting MM gel retardation XX CC GRFI binds alone or together with another component XX DR EMBL: M17242; SCENOD (341:364). XX RN [1] RX MEDLINE; 89218968. RA Buchman A. R., Lue N. F., Kornberg R. D. RT Connections between Transcriptional Activators, Silencers, and Telomeres as RT Revealed by Functional Analysis of a Yeast DNA-Binding Protein RL Mol. Cell. Biol. 8:5086-5099 (1988). RN [2] RX MEDLINE; 88157704. RA Machida M., Uemura H., Jigami Y., Tanaka H. RT The protein factor which binds to the upstream activating sequence of RT Saccharomyces cerevisiae ENOP1 gene RL Nucleic Acids Res. 16:1407-1422 (1988). XX // AC R00416 XX ID Y$ENO1_02 XX DT 20.06.1990 (created); ewi. DT 07.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE ENO1 (enolase); Gene: G000912. XX SQ GCACCCAAACACCtgcaTATTTGG. XX EL UAS87, UAS1 XX S1 ATG SF -473 ST -452 XX BF T01123; EBF1; Quality: 2; Species: yeast, Saccharomyces cerevisiae. BF T00715; RAP1; Quality: 2; Species: yeast, Saccharomyces cerevisiae. XX OS yeast, Saccharomyces cerevisiae OC Eukaryota; Fungi; Ascomycota; Hemiascomycetes; Saccharomycetales; OC Saccharomycetaceae; Saccharomyces. XX SO 0298; yeast SO 0300; rec(yeast-E.coli) XX MM DNase I footprinting MM methylation interference XX CC approx. -433/-412 rel. to cap site XX DR EMBL: M17242; SCENOD (341:364). XX RN [1] RX MEDLINE; 90356004. RA Brindle P. K., Holland J. P., Willett C. E., Innis M. A., Holland M. J. RT Multiple factors bind the upstream activation sites of the yeast enolase RT genes ENO1 and ENO2: ABFI protein, like repressor activator protein RAP1, RT binds cis-acting sequences which modulate repression or activation of RT transcription RL Mol. Cell. Biol. 10:4872-4885 (1990). RN [2] RX MEDLINE; 90005479. RA Machida M., Jigami Y., Tanaka H. RT Purification and characterization of a nuclear factor which binds RT specifically to the upstream sequence of Saccharomyces cerevisiae enolase 1 RT gene RL Eur. J. Biochem. 184:305-311 (1989). XX // AC R00417 XX ID AS$ER_01 XX DT 20.06.1990 (created); ewi. DT 23.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE artificial sequence (artificial ERE). XX SQ CTAGAAAGTCAGGTCACAGTGACCTGATCAAT. XX EL ERE XX BF T00259; ER-alpha; Quality: 2; Species: mouse, Mus musculus. XX SO 0326; rec(mouse-ret lys) XX MM gel retardation XX RN [1] RX MEDLINE; 90199876. RA Fawell S. E., Lees J. A., White R., Parker M. G. RT Characterization and colocalization of steroid binding and dimerization RT activities in the mouse estrogen receptor RL Cell 60:953-962 (1990). XX // AC R00418 XX ID DROME$EVE_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE eve (even-skipped); Gene: G000099. XX SQ TCAGCACCG. XX EL e4 XX SF -194 ST -161 XX BF T00272; Eve; Quality: 6; Species: fruit fly, Drosophila melanogaster. BF T00917; Zen-1; Quality: 6; Species: fruit fly, Drosophila melanogaster. BF T02099; Zen-2; Quality: 6; Species: fruit fly, Drosophila melanogaster. XX MX M00629; I$EVE_Q6 MX M00710; I$ZEN_Q6 XX OS fruit fly, Drosophila melanogaster OC eukaryota; animalia; metazoa; arthropoda; insecta; diptera; drosophiloidea; OC drosophilidae XX SO 0304; rec(Drosophila-E.coli) XX MM DNase I footprinting XX DR TRANSPATH: XN000007416 DR Flybase: FBgn0000606; eve. XX RN [1] RX MEDLINE; 89096828. RA Hoey T., Warrior R., Manak J., Levine M. RT DNA-Binding Activities of Drosophila melanogaster even-skipped Protein Are RT Mediated by Its Homeo Domain and Influenced by Protein Context RL Mol. Cell. Biol. 8:4598-4607 (1988). RN [2] RX MEDLINE; 88189355. RA Hoey T., Levine M. RT Divergent homeo box proteins recognize similar DNA sequences in Drosophila RL Nature 332:858-861 (1988). XX // AC R00420 XX ID DAUCE$EXT_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); rge. CO Copyright (C), Biobase GmbH. XX TY D XX DE extensin; Gene: G000082. XX SF -1800 XX OS carrot, Daucus carota OC eukaryota; viridiplantae; embryobionta; magnoliophyta; magnoliopsida; OC rosidae; apiales; apiaceae XX MM gel retardation XX RN [1] RA Holdsworth M. J., Laties G. G. RT Identification of a wound-induced inhibitor of a nuclear factor that binds RT the carrot extensin gene RL Planta 180:74-81 (1989). XX // AC R00421 XX ID HS$FIX_01 XX DT 20.06.1990 (created); ewi. DT 07.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE factor IX (antihemophilic factor B, christmas factor); Gene: G000256. XX SQ GCCATTGGAAATAGTCCAAAGACC. XX SF -99 ST -76 XX BF T00255; ENKTF-1; Quality: 6; Species: human, Homo sapiens. BF T00599; NF-1/L; Quality: 6; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0104; HepG2 SO 0289; rl XX MM DNase I footprinting XX DR TRANSPATH: XN000007385 DR TRANSPATH: XN000007823 DR EMBL: K02402; HSFIXG (2867:2890). XX RN [1] RX MEDLINE; 90259094. RA Crossley M., Brownlee G. G. RT Disruption of a C/EBP binding site in the factor IX promoter is associated RT with haemophilia B RL Nature 345:444-446 (1990). XX // AC R00422 XX ID HS$FIX_02 XX DT 20.06.1990 (created); ewi. DT 07.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE factor IX (antihemophilic factor B, christmas factor); Gene: G000256. XX SQ ACCACTTTCACAATCTGCTA. XX SF 1 ST 20 XX BF T00105; C/EBPalpha; Quality: 4; Species: human, Homo sapiens. BF T00108; C/EBPalpha; Quality: 2; Species: rat, Rattus norvegicus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0104; HepG2 SO 0289; rl SO 0301; rec(rat-E.coli) XX MM DNase I footprinting MM competitive DNAse I footprint XX DR TRANSPATH: XN000005766 DR TRANSPATH: XN000005767 DR EMBL: K02402; HSFIXG (2966:2985). DR PATHODB: MR000025. XX RN [1] RX MEDLINE; 90259094. RA Crossley M., Brownlee G. G. RT Disruption of a C/EBP binding site in the factor IX promoter is associated RT with haemophilia B RL Nature 345:444-446 (1990). XX // AC R00423 XX ID HS$CBF_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Bf (complement factor B); Gene: G000231. XX SQ TGCAGTTTCTGTTTCCTT. XX SF -143 ST -126 XX BF T00402; ICSBP; Quality: 6; Species: mouse, Mus musculus. XX MX M00699; V$ICSBP_Q6 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0676; rec(mouse-lambda-E.coli) XX MM Southwestern blotting / filter binding XX DR TRANSPATH: XN000005768 DR EMBL: M15082; HSMHBA1 (908:925). DR EPD: EP15054; HS_CFAB. XX RN [1] RX MEDLINE; 90251633. RA Driggers P. H., Ennist D. L., Gleason S. L., Mak W.-H., Marks M. S., Levi RA B.-Z., Flanagan J. R., Appella E., Ozato K. RT An interferon gamma-regulated protein that binds the interferon-inducible RT enhancer element of major histocompatibility complex class I genes RL Proc. Natl. Acad. Sci. USA 87:3743-3747 (1990). RN [2] RX MEDLINE; 90251633. RA Driggers P. H., Ennist D. L., Gleason S. L., Mak W.-H., Marks M. S., Levi RA B.-Z., Flanagan J. R., Appella E., Ozato K. RT An interferon gamma-regulated protein that binds the interferon-inducible RT enhancer element of major histocompatibility complex class I genes RL Proc. Natl. Acad. Sci. USA 87:3743-3747 (1990). XX // AC R00424 XX ID RAT$AFEP_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AFP (alpha-fetoprotein); Gene: G000691. XX SQ TGATTAATAATTACA. XX S1 HindIII at -3.7kb SF 249 ST 277 XX BF T00015; AFP1; Quality: 6; Species: human, Homo sapiens. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0115; HuH-7 XX DR TRANSPATH: XN000007011 XX RN [1] RX MEDLINE; 89218978. RA Sawadaishi K., Morinaga T., Tamaoki T. RT Interaction of a Hepatoma-Specific Nuclear Factor with RT Transcription-Regulatory Sequences of the Human alpha-Fetoprotein and RT Albumin Genes RL Mol. Cell. Biol. 8:5179-5187 (1988). XX // AC R00425 XX ID RAT$AFEP_02 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AFP (alpha-fetoprotein); Gene: G000691. XX SF -232 ST -214 XX BF T00333; GR; Quality: 1; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM DNase I footprinting XX DR TRANSPATH: XN000005769 XX RN [1] RX MEDLINE; 88246406. RA Guertin M., LaRue H., Bernier D., Wrange O., Chevrette M., Gingras M.-C., RA Belanger L. RT Enhancer and Promoter Elements Directing Activation and Glucocorticoid RT Repression of the alpha1-Fetoprotein Gene in Hepatocytes RL Mol. Cell. Biol. 8:1398-1407 (1988). XX // AC R00426 XX ID RAT$AFEP_03 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AFP (alpha-fetoprotein); Gene: G000691. XX SF -211 ST 6 XX BF T00333; GR; Quality: 1; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM DNase I footprinting XX DR TRANSPATH: XN000005769 XX RN [1] RX MEDLINE; 88246406. RA Guertin M., LaRue H., Bernier D., Wrange O., Chevrette M., Gingras M.-C., RA Belanger L. RT Enhancer and Promoter Elements Directing Activation and Glucocorticoid RT Repression of the alpha1-Fetoprotein Gene in Hepatocytes RL Mol. Cell. Biol. 8:1398-1407 (1988). XX // AC R00427 XX ID RAT$AFEP_04 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AFP (alpha-fetoprotein); Gene: G000691. XX SF -200 ST 5 XX BF T00333; GR; Quality: 1; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM DNase I footprinting XX DR TRANSPATH: XN000005769 XX RN [1] RX MEDLINE; 88246406. RA Guertin M., LaRue H., Bernier D., Wrange O., Chevrette M., Gingras M.-C., RA Belanger L. RT Enhancer and Promoter Elements Directing Activation and Glucocorticoid RT Repression of the alpha1-Fetoprotein Gene in Hepatocytes RL Mol. Cell. Biol. 8:1398-1407 (1988). XX // AC R00428 XX ID RAT$AFEP_05 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AFP (alpha-fetoprotein); Gene: G000691. XX SF -179 ST 5 XX BF T00333; GR; Quality: 1; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM DNase I footprinting XX DR TRANSPATH: XN000005769 XX RN [1] RX MEDLINE; 88246406. RA Guertin M., LaRue H., Bernier D., Wrange O., Chevrette M., Gingras M.-C., RA Belanger L. RT Enhancer and Promoter Elements Directing Activation and Glucocorticoid RT Repression of the alpha1-Fetoprotein Gene in Hepatocytes RL Mol. Cell. Biol. 8:1398-1407 (1988). XX // AC R00429 XX ID RAT$AFEP_06 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AFP (alpha-fetoprotein); Gene: G000691. XX SQ TGTCCT. XX SF -172 ST -150 XX BF T00333; GR; Quality: 1; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM DNase I footprinting XX DR TRANSPATH: XN000005769 DR EMBL: X05093; RNAFPG (730:735). DR EMBL: M18351; RRAFPGA (6878:6883). DR EPD: EP17052; RN_FETA. XX RN [1] RX MEDLINE; 88246406. RA Guertin M., LaRue H., Bernier D., Wrange O., Chevrette M., Gingras M.-C., RA Belanger L. RT Enhancer and Promoter Elements Directing Activation and Glucocorticoid RT Repression of the alpha1-Fetoprotein Gene in Hepatocytes RL Mol. Cell. Biol. 8:1398-1407 (1988). XX // AC R00430 XX ID RAT$AFEP_07 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AFP (alpha-fetoprotein); Gene: G000691. XX SQ TTAATTATT. XX SF -169 ST -98 XX BF T00015; AFP1; Quality: 6; Species: human, Homo sapiens. XX MX M00616; V$AFP1_Q6 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0115; HuH-7 XX MM direct gel shift XX DR TRANSPATH: XN000007011 DR EMBL: X05093; RNAFPG (767:775). DR EMBL: M18351; RRAFPGA (6915:6923). DR EPD: EP17052; RN_FETA. XX RN [1] RX MEDLINE; 90098847. RA Nakao K., Miyao Y., Ohe Y., Tamaoki T. RT Involvement of an AFP1-binding site in cell-specific transcription of the RT pre-S1 region of the human hepatitis B virus surface antigen gene RL Nucleic Acids Res. 17:9833 (1989). RN [2] RX MEDLINE; 89218978. RA Sawadaishi K., Morinaga T., Tamaoki T. RT Interaction of a Hepatoma-Specific Nuclear Factor with RT Transcription-Regulatory Sequences of the Human alpha-Fetoprotein and RT Albumin Genes RL Mol. Cell. Biol. 8:5179-5187 (1988). XX // AC R00431 XX ID RAT$AFEP_08 XX DT 20.06.1990 (created); ewi. DT 07.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AFP (alpha-fetoprotein); Gene: G000691. XX SQ TGTTAATTATTGGCAAATTGCCTAACTTCA. XX SF -128 ST -99 XX BF T00368; HNF-1A; Quality: 4; Species: human, Homo sapiens. BF T01950; HNF-1B; Quality: 4; Species: human, Homo sapiens. BF T01951; HNF-1C; Quality: 4; Species: human, Homo sapiens. BF T00535; NF-1; Quality: 6; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0103; Hep3B SO 0289; rl XX MM DNase I footprinting MM gel retardation MM direct gel shift MM gel shift competition XX DR TRANSPATH: XN000007508 DR TRANSPATH: XN000007712 DR TRANSPATH: XN000009099 DR TRANSPATH: XN000009110 DR EMBL: X05093; RNAFPG (765:794). DR EMBL: M18351; RRAFPGA (6913:6942). DR EPD: EP17052; RN_FETA. XX RN [1] RX MEDLINE; 90066425. RA Feuerman M. H., Godbout R., Ingram R. S., Tilghman S. M. RT Tissue-Specific Transcription of the Mouse alpha-Fetoprotein Gene Promoter RT Is Dependent of HNF-1 RL Mol. Cell. Biol. 9:4204-4212 (1989). RN [2] RX MEDLINE; 88273211. RA Jose-Estanyol M., Danan J.-L. RT A Liver-Specific Factor and Nuclear Factor I Bind to the Rat RT alpha-Fetoprotein Promoter RL J. Biol. Chem. 263:10865-10871 (1988). XX // AC R00432 XX ID RAT$AFEP_09 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AFP (alpha-fetoprotein); Gene: G000691. XX SQ GAAGGTTACTAGTTAACAGA. XX SF -65 ST -46 XX BF T00369; HNF-1; Quality: 4; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM DNase I footprinting MM gel retardation MM direct gel shift MM gel shift competition XX DR EMBL: X05093; RNAFPG (828:847). DR EMBL: M18351; RRAFPGA (6976:6995). DR EPD: EP17052; RN_FETA. XX RN [1] RX MEDLINE; 88273211. RA Jose-Estanyol M., Danan J.-L. RT A Liver-Specific Factor and Nuclear Factor I Bind to the Rat RT alpha-Fetoprotein Promoter RL J. Biol. Chem. 263:10865-10871 (1988). XX // AC R00433 XX ID RAT$AFEP_10 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AFP (alpha-fetoprotein); Gene: G000691. XX SF 232 ST 256 XX BF T00333; GR; Quality: 1; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM DNase I footprinting XX DR TRANSPATH: XN000005769 XX RN [1] RX MEDLINE; 88246406. RA Guertin M., LaRue H., Bernier D., Wrange O., Chevrette M., Gingras M.-C., RA Belanger L. RT Enhancer and Promoter Elements Directing Activation and Glucocorticoid RT Repression of the alpha1-Fetoprotein Gene in Hepatocytes RL Mol. Cell. Biol. 8:1398-1407 (1988). XX // AC R00434 XX ID MOUSE$AFEP_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE AFP (alpha-fetoprotein); Gene: G000467. XX SQ GTTACTAGTTAAC. XX EL Ia XX SF -65 ST -50 XX BF T00379; HP1 site factor; Quality: 6; Species: rat, Rattus norvegicus. XX MX M00725; V$HP1SITEFACTOR_Q6 XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl SO 0290; ml XX MM DNase I footprinting MM direct gel shift XX DR TRANSPATH: XN000007528 DR EMBL: J05246; MMAFETO (798:810). DR EMBL: J00349; MMAFP14Z (543:555). DR EPD: EP16045; MM_FETA. XX RN [1] RX MEDLINE; 90153995. RA Zhang D.-E., Hoyt P. R., Papaconstantinou J. RT Localization of DNA Protein-binding Sites in the Proximal and Distal RT Promoter Regions of the Mouse alpha-Fetoprotein Gene RL J. Biol. Chem. 265:3382-3391 (1990). RN [2] RX MEDLINE; 88233915. RA Kugler W., Wagner U., Ryffel G. U. RT Tissue-specificity of liver gene expression: a common liver-specific RT promoter element RL Nucleic Acids Res. 16:3165-3174 (1988). XX // AC R00435 XX ID HS$FIB2_01 XX DT 20.06.1990 (created); ewi. DT 08.03.2002 (updated); hom. CO Copyright (C), Biobase GmbH. XX TY D XX DE FIB2; Gene: G000258. XX SQ GCTCTTGGCCCAAAGCCAGACCGG. XX SF -65 ST -50 XX BF T00539; NF-1; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM DNase I footprinting MM nitrocellulose filter binding XX RN [1] RX MEDLINE; 89356660. RA Cleat P. H., Hay R. T. RT Co-operative interactions between NFI and the adenovirus DNA binding RT protein at the adenovirus origin of replication RL EMBO J. 8:1841-1848 (1989). RN [2] RX MEDLINE; 86140112. RA Adhya S., Shneidman P. S., Hurwitz J. RT Reconstruction of adenovirus replication origins with a human nuclear RT factor I binding site RL J. Biol. Chem. 261:3339-3346 (1986). RN [3] RX MEDLINE; 84248049. RA Gronostajski R. M., Nagata K., Hurwitz J. RT Isolation of human DNA sequences that bind to nuclear factor I, a host RT protein involved in adenovirus DNA replication RL Proc. Natl. Acad. Sci. USA 81:4013-4017 (1984). XX // AC R00436 XX ID RAT$AF_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Fib-A (alpha-fibrinogen); Gene: G000692. XX SQ ATTAAC. XX SF -64 ST -35 XX BF T00369; HNF-1; Quality: 4; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0076; Faza SO 0289; rl XX MM DNase I footprinting MM direct gel shift MM gel shift competition XX DR EMBL: X86561; RNLFIB (1725:1730). DR EPD: EP14035; RN_FIBA. XX RN [1] RX MEDLINE; 88042798. RA Courtois G., Morgan J. G., Campbell L. A., Fourel G., Crabtree G. R. RT Interaction of a liver-specific nuclear factor with the fibrinogen and RT alpha1-antitrypsin promoters RL Science 238:688-692 (1987). XX // AC R00437 XX ID RAT$BF_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE Fib-B (beta-fibrinogen); Gene: G000710. XX SF -145 ST -127 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0076; Faza SO 0289; rl XX MM DNase I footprinting XX RN [1] RX MEDLINE; 88042798. RA Courtois G., Morgan J. G., Campbell L. A., Fourel G., Crabtree G. R. RT Interaction of a liver-specific nuclear factor with the fibrinogen and RT alpha1-antitrypsin promoters RL Science 238:688-692 (1987). XX // AC R00438 XX ID RAT$BF_02 XX DT 20.06.1990 (created); ewi. DT 17.04.2000 (updated); rio. CO Copyright (C), Biobase GmbH. XX TY D XX DE Fib-B (beta-fibrinogen); Gene: G000710. XX RE promoter XX SQ ATTAAC. XX EL beta28 XX SF -103 ST -76 XX BF T00889; HNF-1B; Quality: 6; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0075; Fao flC2 XX MM DNase I footprinting MM gel retardation MM methylation interference MM UV-crosslinking XX DR EMBL: K01336; RNFBB5E (1403:1408). XX RN [1] RX MEDLINE; 89052662. RA Baumhueter S., Courtois G., Crabtree G. R. RT A variant nuclear protein in dedifferentiated hepatoma cells binds to the RT same functional sequences in the beta fibrinogen gene promoter as HNF-1 RL EMBO J. 7:2485-2493 (1988). XX // AC R00439 XX ID RAT$BF_03 XX DT 20.06.1990 (created); ewi. DT 28.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Fib-B (beta-fibrinogen); Gene: G000710. XX SQ CAAACTGTCAAATATTAACTAAAGGGAG. XX EL beta28 XX SF -103 ST -75 XX BF T00369; HNF-1; Quality: 2; Species: rat, Rattus norvegicus. BF T01211; HNF-1A; Quality: 2; Species: mouse, Mus musculus. BF T00890; HNF-1B; Quality: 6; Species: mouse, Mus musculus. BF T01955; vHNF-1; Quality: 6; Species: domestic pig, Sus scrofa. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0071; F9+RA SO 0073; Fao SO 0076; Faza SO 0289; rl SO 0354; rec(mouse-Jurkat) SO 0399; kidney XX MM affinity chromatography MM DNase I footprinting MM direct gel shift MM supershift (antibody binding) XX CC conflict: reference [3] starts with caaactTgt. XX DR EMBL: K01336; RNFBB5E (1390:1417). XX RN [1] RX MEDLINE; 91293099. RA Kuo C. J., Mendel D. B., Hansen L. P., Crabtree G. R. RT Independent regulation of HNF-1alpha and HNF-1beta by retinoic acid in F9 RT teratocarcinoma cells RL EMBO J. 10:2231-2236 (1991). RN [2] RX MEDLINE; 91257571. RA Mendel D. B., Hansen L. P., Graves M. K., Conley P. B., Crabtree G. R. RT HNF-1alpha and HNF-1beta (vHNF-1) share dimerization and homeo domains, but RT not activation domains, and form heterodimers in vitro RL Genes Dev. 5:1042-1056 (1991). RN [3] RX MEDLINE; 91219461. RA Xanthopoulos K. G., Prezioso V. R., Chen W. S., Sladek F. M., Cortese R., RA Darnell jr J. E. RT The different tissue trancription patterns of genes for HNF-1, C/EBP, HNF-3 RT and HNF-4, protein factors that govern liver-specific transcription RL Proc. Natl. Acad. Sci. USA 88:3807-3811 (1991). RN [4] RX MEDLINE; 90249741. RA Baumhueter S., Mendel D. B., Conley P. B., Kuo C. J., Turk C., Graves M. RA K., Edwards C. A., Courtois G., Crabtree G. R. RT HNF-1 shares three sequence motifs with the POU domain proteins and is RT identical to LF-B1 and APF RL Genes Dev. 4:372-379 (1990). RN [5] RX MEDLINE; 88042798. RA Courtois G., Morgan J. G., Campbell L. A., Fourel G., Crabtree G. R. RT Interaction of a liver-specific nuclear factor with the fibrinogen and RT alpha1-antitrypsin promoters RL Science 238:688-692 (1987). XX // AC R00440 XX ID RAT$BF_04 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Fib-B (beta-fibrinogen); Gene: G000710. XX SQ GTCAAATATTAAC. XX SF -98 ST -82 XX BF T00379; HP1 site factor; Quality: 6; Species: rat, Rattus norvegicus. XX MX M00725; V$HP1SITEFACTOR_Q6 XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl XX MM gel retardation XX DR TRANSPATH: XN000007529 DR EMBL: K01336; RNFBB5E (1396:1408). XX RN [1] RX MEDLINE; 88233915. RA Kugler W., Wagner U., Ryffel G. U. RT Tissue-specificity of liver gene expression: a common liver-specific RT promoter element RL Nucleic Acids Res. 16:3165-3174 (1988). XX // AC R00441 XX ID RAT$GF_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Fib-G (gamma-fibrinogen); Gene: G000739. XX SQ GACCCGTGACC. XX SF -85 ST -69 XX BF T00875; USF-1; Quality: 4; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0076; Faza XX MM DNase I footprinting MM gel retardation MM gel shift competition XX DR TRANSPATH: XN000008277 DR EMBL: X05860; RNFIBG1 (1406:1416). DR EPD: EP07094; RN_FIBG. XX RN [1] RX MEDLINE; 88302175. RA Morgan J. G., Courtois G., Fourel G., Chodosh L. A., Campbell L., Evans E., RA Crabtree G. R. RT Sp1, a CAAT-Binding Factor, and the Adenovirus Major Late Promoter RT Transcription Factor Interact with Functional Regions of the RT Gamma-Fibrinogen Promoter RL Mol. Cell. Biol. 8:2628-2637 (1988). XX // AC R00442 XX ID RAT$GF_02 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Fib-G (gamma-fibrinogen); Gene: G000739. XX SQ GACCCGTGACC. XX SF -85 ST -74 XX BF T00873; USF; Quality: 2; Species: yeast, Saccharomyces cerevisiae. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0298; yeast XX MM direct gel shift MM gel shift competition MM methylation interference XX DR EMBL: X05860; RNFIBG1 (1406:1416). DR EPD: EP07094; RN_FIBG. XX RN [1] RX MEDLINE; 89219077. RA Chodosh L. A., Buratowski S., Sharp P. A. RT A Yeast Protein Possesses the DNA-Binding Properties of the Adenovirus RT Major Late Transcription Factor RL Mol. Cell. Biol. 9:820-822 (1989). XX // AC R00443 XX ID RAT$GF_03 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Fib-G (gamma-fibrinogen); Gene: G000739. XX SQ CCCGTGACC. XX SF -83 ST -74 XX BF T00874; USF1; Quality: 2; Species: human, Homo sapiens. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0100; HeLa XX MM affinity chromatography MM gel retardation MM direct gel shift MM gel shift competition MM methylation interference XX DR TRANSPATH: XN000008264 DR EMBL: K01337; RNFBG5E (1410:1418). DR EMBL: X05860; RNFIBG1 (1408:1416). DR EPD: EP07094; RN_FIBG. XX RN [1] RX MEDLINE; 88042797. RA Chodosh L. A., Carthew R. W., Morgan J. G., Crabtree G. R., Sharp P. A. RT The Adenovirus Major Late Transcription Factor Activates the Rat RT gamma-Fibrinogen Promoter RL Science 238:684-688 (1987). XX // AC R00444 XX ID RAT$GF_04 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Fib-G (gamma-fibrinogen); Gene: G000739. XX SQ AGCCACT. XX SF -77 ST -60 XX BF T00152; CP2; Quality: 6; Species: mouse, Mus musculus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0289; rl SO 0290; ml XX MM direct gel shift MM methylation interference XX DR TRANSPATH: XN000007250 DR EMBL: X05860; RNFIBG1 (1423:1429). DR EPD: EP07094; RN_FIBG. XX RN [1] RX MEDLINE; 92046085. RA Tronche F., Rollier A., Sourdive D., Cereghini S., Yaniv M. RT NFY or a related CCAAT binding factor can be replaced by other RT transcriptional activators for co-operation with HNF1 in driving the rat RT albumin promoter in vivo RL J. Mol. Biol. 222:31-43 (1991). RN [2] RX MEDLINE; 88165047. RA Chodosh L. A., Baldwin jr A. S., Carthew R. W., Sharp P. A. RT Human CCAAT-Binding Proteins Have Heterologous Subunits RL Cell 53:11-24 (1988). XX // AC R00445 XX ID RAT$GF_05 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Fib-G (gamma-fibrinogen); Gene: G000739. XX SQ GCCACTCT. XX SF -66 ST -53 XX BF T00084; CBF (2); Quality: 6; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0076; Faza XX MM DNase I footprinting MM gel retardation XX DR TRANSPATH: XN000007155 DR EMBL: K01337; RNFBG5E (1426:1433). DR EMBL: X05860; RNFIBG1 (1424:1431). DR EPD: EP07094; RN_FIBG. XX RN [1] RX MEDLINE; 88302175. RA Morgan J. G., Courtois G., Fourel G., Chodosh L. A., Campbell L., Evans E., RA Crabtree G. R. RT Sp1, a CAAT-Binding Factor, and the Adenovirus Major Late Promoter RT Transcription Factor Interact with Functional Regions of the RT Gamma-Fibrinogen Promoter RL Mol. Cell. Biol. 8:2628-2637 (1988). XX // AC R00446 XX ID RAT$GF_06 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Fib-G (gamma-fibrinogen); Gene: G000739. XX SQ GTCCCGCCCA. XX SF -58 ST -43 XX BF T00754; Sp1; Quality: 1; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0076; Faza XX MM DNase I footprinting MM gel shift competition XX DR EMBL: K01337; RNFBG5E (1437:1446). DR EMBL: X05860; RNFIBG1 (1434:1443). DR EPD: EP07094; RN_FIBG. XX RN [1] RX MEDLINE; 88302175. RA Morgan J. G., Courtois G., Fourel G., Chodosh L. A., Campbell L., Evans E., RA Crabtree G. R. RT Sp1, a CAAT-Binding Factor, and the Adenovirus Major Late Promoter RT Transcription Factor Interact with Functional Regions of the RT Gamma-Fibrinogen Promoter RL Mol. Cell. Biol. 8:2628-2637 (1988). XX // AC R00447 XX ID RAT$GF_07 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE Fib-G (gamma-fibrinogen); Gene: G000739. XX SQ CCGCCC. XX SF -51 ST -46 XX BF T00754; Sp1; Quality: 1; Species: rat, Rattus norvegicus. XX OS rat, Rattus norvegicus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0076; Faza XX MM DNase I footprinting MM gel retardation MM gel shift competition XX DR EMBL: K01337; RNFBG5E (1440:1445). DR EMBL: X05860; RNFIBG1 (1437:1442). DR EPD: EP07094; RN_FIBG. XX RN [1] RX MEDLINE; 88302175. RA Morgan J. G., Courtois G., Fourel G., Chodosh L. A., Campbell L., Evans E., RA Crabtree G. R. RT Sp1, a CAAT-Binding Factor, and the Adenovirus Major Late Promoter RT Transcription Factor Interact with Functional Regions of the RT Gamma-Fibrinogen Promoter RL Mol. Cell. Biol. 8:2628-2637 (1988). XX // AC R00448 XX ID BOMMO$F_01 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE fibroin; Gene: G000032. XX SF -234 ST -66 XX BF T00443; 75 kDa protein; Quality: 6; Species: silk moth, Bombyx mori. XX OS silk moth, Bombyx mori OC eukaryota; animalia; metazoa; arthropoda; insecta; lepidoptera; OC bombycoidea; bombycidae XX MM Southwestern blotting / filter binding XX DR TRANSPATH: XN000007589 XX RN [1] RX MEDLINE; 89174718. RA Matsuno K., Suzuki T., Takiya S., Suzuki Y. RT Complex Formation with the Fibroin Gene Enhancer through a Protein-Protein RT Interaction Analyzed by a Modified DNA-binding Assay RL J. Biol. Chem. 264:4599-4604 (1989). XX // AC R00449 XX ID BOMMO$F_02 XX DT 20.06.1990 (created); ewi. DT 08.05.1998 (updated); tme. CO Copyright (C), Biobase GmbH. XX TY D XX DE fibroin; Gene: G000032. XX SQ TAAGAACAATAAGATCAATTAAATCATAATTAATCACATTGTTC. XX SF -217 ST -174 XX BF T00745; SGF-2; Quality: 6; Species: silk moth, Bombyx mori. BF T00746; SGF-3; Quality: 6; Species: silk moth, Bombyx mori. BF T00747; SGF-4; Quality: 6; Species: silk moth, Bombyx mori. XX MX M00662; I$SGF3_Q6 XX OS silk moth, Bombyx mori OC eukaryota; animalia; metazoa; arthropoda; insecta; lepidoptera; OC bombycoidea; bombycidae XX SO 0647; ovary SO 0658; silk gland SO 0671; Bm-e21 XX MM DNase I footprinting MM exonuclease digests MM gel retardation XX DR TRANSPATH: XN000008036 DR TRANSPATH: XN000008037 DR EMBL: V00094; BMFIBR (334:377). XX RN [1] RX MEDLINE; 90294285. RA Hui C.-C., Matsuno K., Suzuki Y. RT Fibroin Gene Promoter Contains a Cluster of Homeodomain Binding Sites that RT Interact with Three Silk Gland Factors RL J. Mol. Biol. 213:651-670 (1990). RN [2] RX MEDLINE; 88186926. RA Suzuki T., Suzuki Y. RT Interaction of Composite Protein Complex with Fibroin Enhancer Sequence RL J. Biol. Chem. 263:5979-5986 (1988). XX // AC R00450 XX ID BOMMO$F_03 XX DT 20.06.1990 (created); ewi. DT 08.05.1998 (updated); tme. CO Copyright (C), Biobase GmbH. XX TY D XX DE fibroin; Gene: G000032. XX SQ TCACAATTTAATTTACTTCATACGTTGTATT. XX SF -169 ST -139 XX BF T00745; SGF-2; Quality: 6; Species: silk moth, Bombyx mori. BF T00746; SGF-3; Quality: 6; Species: silk moth, Bombyx mori. BF T00747; SGF-4; Quality: 6; Species: silk moth, Bombyx mori. XX MX M00662; I$SGF3_Q6 XX OS silk moth, Bombyx mori OC eukaryota; animalia; metazoa; arthropoda; insecta; lepidoptera; OC bombycoidea; bombycidae XX SO 0647; ovary SO 0658; silk gland SO 0671; Bm-e21 XX MM DNase I footprinting MM exonuclease digests MM gel retardation XX DR TRANSPATH: XN000008036 DR TRANSPATH: XN000008037 DR EMBL: V00094; BMFIBR (382:412). XX RN [1] RX MEDLINE; 90294285. RA Hui C.-C., Matsuno K., Suzuki Y. RT Fibroin Gene Promoter Contains a Cluster of Homeodomain Binding Sites that RT Interact with Three Silk Gland Factors RL J. Mol. Biol. 213:651-670 (1990). RN [2] RX MEDLINE; 88186926. RA Suzuki T., Suzuki Y. RT Interaction of Composite Protein Complex with Fibroin Enhancer Sequence RL J. Biol. Chem. 263:5979-5986 (1988). XX // AC R00451 XX ID BOMMO$F_04 XX DT 20.06.1990 (created); ewi. DT 08.05.1998 (updated); tme. CO Copyright (C), Biobase GmbH. XX TY D XX DE fibroin; Gene: G000032. XX SQ TAAATAAAAAGATTAATTTCTATGTAATTGT. XX SF -132 ST -100 XX BF T00745; SGF-2; Quality: 6; Species: silk moth, Bombyx mori. BF T00746; SGF-3; Quality: 6; Species: silk moth, Bombyx mori. BF T00747; SGF-4; Quality: 6; Species: silk moth, Bombyx mori. XX MX M00662; I$SGF3_Q6 XX OS silk moth, Bombyx mori OC eukaryota; animalia; metazoa; arthropoda; insecta; lepidoptera; OC bombycoidea; bombycidae XX SO 0647; ovary SO 0658; silk gland SO 0671; Bm-e21 XX MM DNase I footprinting MM exonuclease digests MM gel retardation XX DR TRANSPATH: XN000008036 DR TRANSPATH: XN000008037 DR EMBL: V00094; BMFIBR (420:450). XX RN [1] RX MEDLINE; 90294285. RA Hui C.-C., Matsuno K., Suzuki Y. RT Fibroin Gene Promoter Contains a Cluster of Homeodomain Binding Sites that RT Interact with Three Silk Gland Factors RL J. Mol. Biol. 213:651-670 (1990). RN [2] RX MEDLINE; 88186926. RA Suzuki T., Suzuki Y. RT Interaction of Composite Protein Complex with Fibroin Enhancer Sequence RL J. Biol. Chem. 263:5979-5986 (1988). XX // AC R00452 XX ID BOMMO$F_05 XX DT 20.06.1990 (created); ewi. DT 08.05.1998 (updated); tme. CO Copyright (C), Biobase GmbH. XX TY D XX DE fibroin; Gene: G000032. XX SQ GTCAAAACTCGAAAATTTTCAGTATAAAAAGGTTCAA. XX SF -42 ST -16 XX OS silk moth, Bombyx mori OC eukaryota; animalia; metazoa; arthropoda; insecta; lepidoptera; OC bombycoidea; bombycidae XX SO 0174; psg SO 0647; ovary SO 0658; silk gland SO 0671; Bm-e21 XX MM DNase I footprinting MM exonuclease digests MM gel retardation XX CC spans TATA box XX DR EMBL: V00094; BMFIBR (499:535). XX RN [1] RX MEDLINE; 90151625. RA Takiya S., Hui C.-C., Suzuki Y. RT A contribution of the core-promoter and its surrounding regions to the RT preferential transcription of the fibroin gene in posterior silk gland RT extracts RL EMBO J. 9:489-496 (1990). RN [2] RX MEDLINE; 90294285. RA Hui C.-C., Matsuno K., Suzuki Y. RT Fibroin Gene Promoter Contains a Cluster of Homeodomain Binding Sites that RT Interact with Three Silk Gland Factors RL J. Mol. Biol. 213:651-670 (1990). XX // AC R00453 XX ID BOMMO$F_06 XX DT 20.06.1990 (created); ewi. DT 13.05.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE fibroin; Gene: G000032. XX SQ AAATCAGCATCAGTTC. XX EL IR XX SF -8 ST 8 XX OS silk moth, Bombyx mori OC eukaryota; animalia; metazoa; arthropoda; insecta; lepidoptera; OC bombycoidea; bombycidae XX SO 0174; psg SO 0647; ovary SO 0658; silk gland SO 0671; Bm-e21 XX MM DNase I footprinting MM exonuclease digests MM gel retardation XX DR EMBL: V00094; BMFIBR (543:558). XX RN [1] RX MEDLINE; 90151625. RA Takiya S., Hui C.-C., Suzuki Y. RT A contribution of the core-promoter and its surrounding regions to the RT preferential transcription of the fibroin gene in posterior silk gland RT extracts RL EMBO J. 9:489-496 (1990). RN [2] RX MEDLINE; 90294285. RA Hui C.-C., Matsuno K., Suzuki Y. RT Fibroin Gene Promoter Contains a Cluster of Homeodomain Binding Sites that RT Interact with Three Silk Gland Factors RL J. Mol. Biol. 213:651-670 (1990). XX // AC R00454 XX ID HS$FN_01 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE FN (fibronectin); Gene: G000259. XX SQ GTGACGCAAT. XX SF -430 ST -402 XX BF T00163; CREB; Quality: 2; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0003; 3T3 SO 0114; HT-1080 SO 0289; rl SO 0738; BGC-1 XX MM DNase I footprinting MM gel retardation MM gel shift competition XX CC functional forskolin-inducible element XX DR TRANSPATH: XN000005770 DR EMBL: M26179; HSFNA (89:98). XX RN [1] RX MEDLINE; 91093221. RA Bowlus Ch. L., McQuillan J. J., Dean D. C. RT Characterization of three different elements in the 5'-flanking region of RT the fibronectin gene which mediate a transcriptional response to cAMP RL J. Biol. Chem. 266:1122-1127 (1991). RN [2] RX MEDLINE; 91009310. RA Bernath V. A., Muro A. F., Vitullo A. D., Bley M. A., Baranao J. L., RA Kornblihtt A. R. RT Cyclic AMP inhibits fibronectin gene expression in a newly developed RT granulosa cell line by a mechanism that suppresses cAMP-responsive RT element-dependent transcriptional activation RL J. Biol. Chem. 265:18219-18226 (1990). RN [3] RX MEDLINE; 89261777. RA Dean D. C., Blakeley M. S., Newby R. F., Ghazal P., Hennighausen L., RA Bourgeois S. RT Forskolin Inducibility and Tissue-Specific Expression of the Fibronectin RT Promoter RL Mol. Cell. Biol. 9:1498-1506 (1989). XX // AC R00455 XX ID HS$FN_02 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE FN (fibronectin); Gene: G000259. XX SQ GTGACGTCAC. XX EL CRE XX SF -194 ST -160 XX BF T00133; c-Jun; Quality: 2; Species: human, Homo sapiens. BF T00167; CRE-BP1; Quality: 2; Species: human, Homo sapiens. BF T00163; CREB; Quality: 2; Species: human, Homo sapiens. BF T01380; CREB; Quality: 6; Species: mink, Mustela vison. BF T01381; deltaCREB; Quality: 6; Species: mink, Mustela vison. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0003; 3T3 SO 0114; HT-1080 SO 0289; rl SO 0323; rec(human-ret lys) SO 0738; BGC-1 XX MM DNase I footprinting MM direct gel shift MM supershift (antibody binding) XX CC functional forskolin-inducible element; protein binding inducible by serum CC in 3T3, not in JEG-3 cells; CREB-binding not affected by TGF-beta1-induced CC phosphorylation by a kinase different from PKA XX DR TRANSPATH: XN000005770 DR TRANSPATH: XN000005771 DR TRANSPATH: XN000005772 DR TRANSPATH: XN000008809 DR TRANSPATH: XN000008811 DR EMBL: M26179; HSFNA (334:343). XX RN [1] RX MEDLINE; 94248047. RA Benbrook D. M., Jones N. C. RT Different binding specificities and transactivation of variant CRE's by RT CREB complexes RL Nucleic Acids Res. 22:1463-1469 (1994). RN [2] RX MEDLINE; 91216102. RA Kramer I. M., Koornneef I., de Laat S. W., van den Eijnden-van Raaij A. J. RA M. RT TGF-beta1 induces phosphorylation of the cyclic AMP responsive element RT binding protein in ML-CCI64 cells RL EMBO J. 10:1083-1089 (1991). RN [3] RX MEDLINE; 91093221. RA Bowlus Ch. L., McQuillan J. J., Dean D. C. RT Characterization of three different elements in the 5'-flanking region of RT the fibronectin gene which mediate a transcriptional response to cAMP RL J. Biol. Chem. 266:1122-1127 (1991). RN [4] RX MEDLINE; 91009310. RA Bernath V. A., Muro A. F., Vitullo A. D., Bley M. A., Baranao J. L., RA Kornblihtt A. R. RT Cyclic AMP inhibits fibronectin gene expression in a newly developed RT granulosa cell line by a mechanism that suppresses cAMP-responsive RT element-dependent transcriptional activation RL J. Biol. Chem. 265:18219-18226 (1990). RN [5] RX MEDLINE; 91125364. RA Andersen B., Kennedy G. C., Hamernik D. L., Bokar J. A., Bohinski R., RA Nilson J. H. RT Amplification of the transcriptional signal mediated by the tandem cAMP RT response elements of the glycoprotein hormone alpha-subunit gene occurs RT through several distinct mechanisms RL Mol. Endocrinol. 4:573-582 (1990). RN [6] RX MEDLINE; 90191714. RA Benbrook D. M., Jones N. C. RT Heterodimer formation between CREB and JUN proteins RL Oncogene 5:295-302 (1990). RN [7] RX MEDLINE; 89261777. RA Dean D. C., Blakeley M. S., Newby R. F., Ghazal P., Hennighausen L., RA Bourgeois S. RT Forskolin Inducibility and Tissue-Specific Expression of the Fibronectin RT Promoter RL Mol. Cell. Biol. 9:1498-1506 (1989). XX // AC R00456 XX ID HS$FN_03 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE FN (fibronectin); Gene: G000259. XX SQ TGACGTCA. XX SF -184 ST -155 XX BF T00163; CREB; Quality: 4; Species: human, Homo sapiens. BF T00989; CREB; Quality: 6; Species: mouse, Mus musculus. BF T02361; CREBbeta; Quality: 6; Species: mouse, Mus musculus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa SO 0303; rec(mouse-E.coli) SO 0679; rec(human-) XX MM direct gel shift XX DR TRANSPATH: XN000005770 DR TRANSPATH: XN000005773 DR TRANSPATH: XN000009231 DR EMBL: M26179; HSFNA (335:342). XX RN [1] RX MEDLINE; 92371441. RA Nichols M., Weih F., Schmid W., DeVack C., Kowenz-Leutz E., Luckow B., RA Boshart M., Schuetz G. RT Phosphorylation of CREB affects its binding to high and low affinity sites: RT implications for cAMP induced gene transcription RL EMBO J. 11:3337-3346 (1992). RN [2] RX MEDLINE; 88247984. RA Hardy S., Shenk T. RT Adenoviral control regions activated by E1A and the cAMP responsive element RT bind to the same factor RL Proc. Natl. Acad. Sci. USA 85:4171-4175 (1988). XX // AC R00457 XX ID HS$FN_04 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE FN (fibronectin); Gene: G000259. XX SQ CGGAGCCCGGGCCAAT. XX SF -160 ST -142 XX BF T00539; NF-1; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0114; HT-1080 SO 0289; rl XX MM DNase I footprinting MM gel retardation XX DR EMBL: M26179; HSFNA (345:360). XX RN [1] RX MEDLINE; 91009310. RA Bernath V. A., Muro A. F., Vitullo A. D., Bley M. A., Baranao J. L., RA Kornblihtt A. R. RT Cyclic AMP inhibits fibronectin gene expression in a newly developed RT granulosa cell line by a mechanism that suppresses cAMP-responsive RT element-dependent transcriptional activation RL J. Biol. Chem. 265:18219-18226 (1990). RN [2] RX MEDLINE; 89261777. RA Dean D. C., Blakeley M. S., Newby R. F., Ghazal P., Hennighausen L., RA Bourgeois S. RT Forskolin Inducibility and Tissue-Specific Expression of the Fibronectin RT Promoter RL Mol. Cell. Biol. 9:1498-1506 (1989). XX // AC R00458 XX ID HS$CFOS_01 XX DT 20.06.1990 (created); ewi. DT 28.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SQ CAGTTCCCGTCAATC. XX EL SIF-E XX SF -346 XX BF T00748; SIF; Quality: 6; Species: mouse, Mus musculus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0003; 3T3 XX MM gel retardation MM methylation interference XX CC confers sis/PDGF-inducibility onto c-fos XX DR TRANSPATH: XN000008038 DR EMBL: K00650; HSFOS (383:397). XX RN [1] RX MEDLINE; 91092272. RA Wagner B. J., Hayes T. E., Hoban C. J., Cochran B. H. RT The SIF binding element confers sis/PDGF inducibility onto the c-fos RT promoter RL EMBO J. 9:4477-4484 (1990). RN [2] RX MEDLINE; 87147256. RA Hayes T. E., Kitchen A. M., Cochran B. H. RT Inducible binding of a factor to the c-fos regulatory region RL Proc. Natl. Acad. Sci. USA 84:1272-1276 (1987). XX // AC R00459 XX ID HS$CFOS_02 XX DT 20.06.1990 (created); ewi. DT 08.07.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SQ tcccGtcaa. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0466; A431 + EGF XX MM methylation interference XX DR EMBL: K00650; HSFOS (387:395). XX RN [1] RX MEDLINE; 89295579. RA Herrera R. E., Shaw P. E., Nordheim A. RT Occupation of the c-fos serum response element in vivo by a multi-protein RT complex is unaltered by growth factor induction RL Nature 340:68-70 (1989). XX // AC R00460 XX ID HS$CFOS_03 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SQ CCCCCCTTACACAGGATGTCCATATTAGGACATCTGCGTC. XX EL DSE XX SF -332 ST -293 XX BF T00672; p67; Quality: 4; Species: human, Homo sapiens. BF T00801; TCF; Quality: 5; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 XX MM DNase I footprinting MM methylation interference XX DR TRANSPATH: XN000005774 DR TRANSPATH: XN000007888 DR EMBL: K00650; HSFOS (401:440). XX RN [1] RX MEDLINE; 89295579. RA Herrera R. E., Shaw P. E., Nordheim A. RT Occupation of the c-fos serum response element in vivo by a multi-protein RT complex is unaltered by growth factor induction RL Nature 340:68-70 (1989). XX // AC R00461 XX ID HS$CFOS_04 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SQ GATGTCCatattaGGACATC. XX SF -323 ST -293 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM DNase I footprinting MM gel retardation XX DR EMBL: M15429; HSCFOS01 (14:33). DR EMBL: K00650; HSFOS (415:434). XX RN [1] RX MEDLINE; 88065484. RA Prywes R., Roeder R. G. RT Purification of the c-fos enhancer-binding protein RL Mol. Cell. Biol. 7:3482-3489 (1987). XX // AC R00462 XX ID HS$CFOS_05 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SF -323 ST -277 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa SO 0170; PC12 XX MM gel retardation MM direct gel shift XX RN [1] RX MEDLINE; 89071721. RA Visvader J., Sassone-Corsi P., Verma I. RT Two adjacent promoter elements mediate nerve growth factor activation of RT the c-fos gene and bind distinct nuclear complexes RL Proc. Natl. Acad. Sci. USA 85:9474-9478 (1988). XX // AC R00463 XX ID HS$CFOS_06 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SQ CCATATTAGG. XX SF -320 ST -295 XX BF T00765; SRF (504 AA); Quality: 3; Species: mouse, Mus musculus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0042; C2 myoblasts XX MM gel retardation XX CC conflict: HSCFOS(19:) is aagcgcccag XX DR TRANSPATH: XN000008085 DR EMBL: K00650; HSFOS (420:429). DR EPD: EP11145; HS_FOS. XX RN [1] RX MEDLINE; 89219044. RA Boxer L. M., Prywes R., Roeder R. G., Kedes L. RT The Sarcomeric Actin CArG-Binding Factor Is Indistinguishable from the RT c-fos Serum Response Factor RL Mol. Cell. Biol. 9:515-522 (1989). RN [2] RX MEDLINE; 89184588. RA Gustafson T. A., Taylor A., Kedes L. RT DNA bending is induced by a transcription factor that interacts with the RT human c-FOS and alpha-actin promoters RL Proc. Natl. Acad. Sci. USA 86:2162-2166 (1989). XX // AC R00464 XX ID HS$CFOS_07 XX DT 20.06.1990 (created); ewi. DT 04.12.2000 (updated); dkl. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SQ GATGTCCatattaGGACATC. XX EL SRE XX SF -320 ST -299 XX BF T00459; C/EBPbeta; Quality: 6; Species: rat, Rattus norvegicus. BF T01461; SRE BP; Quality: 6; Species: chick, Gallus gallus. BF T00764; SRF; Quality: 1; Species: human, Homo sapiens. BF T00765; SRF (504 AA); Quality: 1; Species: mouse, Mus musculus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0042; C2 myoblasts SO 0048; CEF SO 0100; HeLa SO 0135; L SO 0170; PC12 SO 0306; rec(human-E.coli) SO 0323; rec(human-ret lys) XX MM DNase I footprinting MM direct gel shift MM supershift (antibody binding) MM methylation protection MM methylation interference XX CC besides SRF and TCF binding: p36, p45, p72, p112; factor binding in PC12 CC cells induced by forskolin; antibodies against NF-IL6 (binds to 3' half); CC SRE BP (chicken) binds same sequence as NF-IL6 XX DR TRANSPATH: XN000005775 DR TRANSPATH: XN000008085 DR TRANSPATH: XN000008856 DR TRANSPATH: XN000014286 DR EMBL: M15429; HSCFOS01 (14:33). DR EMBL: K00650; HSFOS (415:434). XX RN [1] RX MEDLINE; 94344102. RA Johansen F.-E., Prywes R. RT Two pathways for serum regulation of the c-fos serum response element RT require specific sequence elements and a minimal domain of serum response RT factor RL Mol. Cell. Biol. 14:5920-5928 (1994). RN [2] RX MEDLINE; 93024422. RA Boulden A. M., Sealy L. J. RT Maximal serum stimulation of the c-fos serum response element requires both RT the serum response factor and a novel binding factor, SRE-binding protein RL Mol. Cell. Biol. 12:4769-4783 (1992). RN [3] RX MEDLINE; 92009167. RA Metz R., Ziff E. RT cAMP stimulates the C/EBP-related transcription factor rNFIL-6 to RT trans-locate to the nucleus and induce c-fos transcription RL Genes Dev. 5:1754-1766 (1991). RN [4] RX MEDLINE; 91203896. RA de Belle I., Walker P. R., Smith I. C. P., Sikorska M. RT Identification of a multiprotein complex interacting with the c-fos serum RT response element RL Mol. Cell. Biol. 11:2752-2759 (1991). RN [5] RX MEDLINE; 91288203. RA Latinkic B. V., O'Brien T. P., Lau L. F. RT Promoter function and structure of the growth factor-inducible immediate RT early gene cyr61 RL Nucleic Acids Res. 19:3261 (1991). RN [6] RX MEDLINE; 90249731. RA Rivera V. M., Sheng M., Greenberg M. E. RT The inner core of the serum response element mediates both rapid induction RT and subsequent repression of c-fos transcription following serum stimulation RL Genes Dev. 4:255-268 (1990). RN [7] RX MEDLINE; 90346294. RA Manak J. R., de Bisschop N., Kris R. M., Prywes R. RT Casein kinase II enhances the DNA binding activity of serum response factor RL Genes Dev. 4:955-967 (1990). RN [8] RX MEDLINE; 90294287. RA Tuil D., Clergue N., Montarras D., Pinset Ch., Kahn A., Phan-Dinh-Tuy F. RT CC Ar GG boxes, cis-acting elements with a dual specificity: RT Muscle-specific transcriptional activation and serum responsiveness RL J. Mol. Biol. 213:677-686 (1990). RN [9] RX MEDLINE; 89160246. RA Leung S., Miyamoto N. G. RT Point mutational analysis of the human c-fos serum response factor binding RT site RL Nucleic Acids Res. 17:1177 (1989). RN [10] RX MEDLINE; 89196889. RA Hayes T. E., Sengupta P., Cochran B. H. RT The human c-fos serum response factor and the yeast factors GRM/PRTF have RT related DNA-binding specificities RL Genes Dev. 2:1713-1722 (1988). RN [11] RX MEDLINE; 87172790. RA Greenberg M. E., Siegfried Z., Ziff E. B. RT Mutation of the c-fos gene dyad symmetry element inhibits serum RT inducibility of transcription in vivo and the nuclear regulatory factor RT binding in vitro RL Mol. Cell. Biol. 7:1217-1225 (1987). RN [12] RX MEDLINE; 88096559. RA Schroeter H., Shaw P. E., Nordheim A. RT Purification of intercalator-released p67, a polypeptide that interacts RT specifically with the c-fos serum response element RL Nucleic Acids Res. 15:10145-10158 (1987). RN [13] RX MEDLINE; 86272105. RA Treisman R. RT Identification of a protein-binding site that mediates transcriptional RT response of the c-fos gene to serum factors RL Cell 46:567-574 (1986). XX // AC R00465 XX ID HS$CFOS_08 XX DT 20.06.1990 (created); ewi. DT 07.09.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SQ GATGTCC. XX SF -319 ST -313 XX BF T00765; SRF (504 AA); Quality: 1; Species: mouse, Mus musculus. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0003; 3T3 SO 0095; H9 XX MM gel retardation MM methylation interference XX DR TRANSPATH: XN000008085 DR EMBL: M15429; HSCFOS01 (14:20). DR EMBL: K00650; HSFOS (415:421). XX RN [1] RX MEDLINE; 89313766. RA Walsh K. RT Cross-Binding of Factors to Functionally Different Promoter Elements in RT c-fos and Skeletal Actin Genes RL Mol. Cell. Biol. 9:2191-2201 (1989). XX // AC R00466 XX ID HS$CFOS_09 XX DT 20.06.1990 (created); ewi. DT 12.06.1995 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SQ CAGGATGTCCATATTAGGACATC. XX EL DSE in SRE XX SF -319 ST -302 XX BF T01007; AG; Quality: 6; Species: thale cress, Arabidopsis thaliana. BF T01773; AG; Quality: 6; Species: rape, Brassica napus. BF T01776; AP3; Quality: 6; Species: thale cress, Arabidopsis thaliana. BF T00043; ARG80; Quality: 2; Species: yeast, Saccharomyces cerevisiae. BF T01008; DEF; Quality: 6; Species: garden snapdragon, Antirrhinum majus. BF T00250; Elk-1; Quality: 6; Species: human, Homo sapiens. BF T01777; GP; Quality: 6; Species: Petunia hybrida. BF T00500; MCM1; Quality: 2; Species: yeast, Saccharomyces cerevisiae. BF T01413; Net; Quality: 6; Species: mouse, Mus musculus. BF T00737; SAP-1a; Quality: 2; Species: human, Homo sapiens. BF T02128; SAP-1b; Quality: 2; Species: human, Homo sapiens. BF T00764; SRF; Quality: 2; Species: human, Homo sapiens. BF T00765; SRF (504 AA); Quality: 2; Species: mouse, Mus musculus. BF T00801; TCF; Quality: 2; Species: human, Homo sapiens. BF T01399; TCF; Quality: 2; Species: mouse, Mus musculus. BF T00915; YY1; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0003; 3T3 SO 0023; A431 SO 0100; HeLa SO 0306; rec(human-E.coli) SO 0323; rec(human-ret lys) SO 0324; rec(yeast-ret lys) SO 0326; rec(mouse-ret lys) SO 0339; rec(human-vaccinia virus-HeLa) SO 0519; rec(yeast-vaccinia-) SO 0520; rec(Antirrhinum-ret lys) SO 0521; rec(Arabidopsis-ret lys) SO 0744; rec(human-3T3) XX MM affinity chromatography MM DNase I footprinting MM direct gel shift MM methylation interference MM UV-crosslinking XX CC KD(YY-1)= 40 nM; KD(SRF)= 2.5 nM; YY-1 and SRF compete, YY-1 suppresses CC serum induction and basal expression; conflict: HSCFOS(11:) is CC ggccgcagaagcgcccaggcccg XX DR TRANSPATH: XN000005774 DR TRANSPATH: XN000005776 DR TRANSPATH: XN000005777 DR TRANSPATH: XN000005778 DR TRANSPATH: XN000008085 DR TRANSPATH: XN000008337 DR TRANSPATH: XN000008828 DR TRANSPATH: XN000014286 DR EMBL: K00650; HSFOS (412:434). DR EPD: EP11145; HS_FOS. XX RN [1] RX MEDLINE; 95047310. RA Giovane A., Pintzas A., Maira S.-M., Sobieszczuk P., Wasylyk B. RT Net, a new ets transcription factor that is activated by Ras RL Genes Dev. 8:1502-1513 (1994). RN [2] RX MEDLINE; 93238285. RA Marais R., Wynne J., Treisman R. RT The SRF accessory protein Elk-1 contains a growth factor-regulated RT transcriptional activation domain RL Cell 73:381-393 (1993). RN [3] RX MEDLINE; 93109295. RA Sharrocks A. D., Gille H., Shaw P. E. RT Identification of amino acids essential for DNA binding and dimerization in RT p67SRF: implications for a novel DNA-binding motif RL Mol. Cell. Biol. 13:123-132 (1993). RN [4] RX MEDLINE; 92154673. RA Dalton S., Treisman R. RT Characterization of SAP-1, a protein recruited by serum response factor to RT the c-fos serum response element RL Cell 68:597-612 (1992). RN [5] RX MEDLINE; 93049215. RA Treisman R., Marais R., Wynne J. RT Spatial flexibility in ternary complexes between SRF and its accessory RT proteins RL EMBO J. 11:4631-4640 (1992). RN [6] RX MEDLINE; 92375089. RA Gualberto A., LePage D., Pons G., Mader S. L., Park K., Atchison M. L., RA Walsh K. RT Functional antagonism between YY1 and the serum response factor RL Mol. Cell. Biol. 12:4209-4214 (1992). RN [7] RX MEDLINE; 92350282. RA Gille H., Sharrocks A. D., Shaw P. E. RT Phosphorylation of transcription factor p62TCF by MAP kinase stimulates RT ternary complex formation at c-fos promoter RL Nature 358:414-417 (1992). RN [8] RX MEDLINE; 92347336. RA Shaw P. E. RT Ternary complex formation over the c-fos serum response element: p62TCF RT exhibits dual component specificity with contacts to DNA and an extended RT structure in the DNA-binding domain of p67SRF RL EMBO J. 11:3011-3019 (1992). RN [9] RX MEDLINE; 92097542. RA Mueller C. G. F., Nordheim A. RT A protein domain conserved between yeast MCM1 and human SRF directs ternary RT complex formation RL EMBO J. 10:4219-4229 (1991). RN [10] RX MEDLINE; 92100194. RA Hipskind R. A., Rao V. N., Mueller C. G. F., Reddy E. S. P., Nordheim A. RT Ets-related protein Elk-1 is homologous to the c-fos regulatory factor RT p62TCF RL Nature 354:531-534 (1991). RN [11] RX MEDLINE; 91102565. RA Graham R., Gilman M. RT Distinct protein targets for signals acting at the c-fos serum response RT element RL Science 251:189-192 (1991). RN [12] RX MEDLINE; 90214621. RA Schroeter H., Mueller C. G. F., Meese K., Nordheim A. RT Synergism in ternary complex formation between the dimeric glycoprotein RT p67SRF, polypeptide p62TCF and the c-fos serum response element RL EMBO J. 9:1123-1130 (1990). RN [13] RX MEDLINE; 89136003. RA Shaw P. E., Schroeter H., Nordheim A. RT The Ability of a Ternary Complex to Form Over the Serum Response Element RT Correlates with Serum Inducibility of the Human c-fos Promoter RL Cell 56:563-572 (1989). RN [14] RX MEDLINE; 89295579. RA Herrera R. E., Shaw P. E., Nordheim A. RT Occupation of the c-fos serum response element in vivo by a multi-protein RT complex is unaltered by growth factor induction RL Nature 340:68-70 (1989). XX // AC R00467 XX ID HS$CFOS_10 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SQ GATGTCCATATTAGGACATC. XX EL DSE in SRE XX SF -315 ST -302 XX BF T00672; p67; Quality: 2; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 SO 0100; HeLa XX MM gel retardation MM gel shift competition MM methylation interference XX DR TRANSPATH: XN000007888 DR EMBL: M15429; HSCFOS01 (14:33). DR EMBL: K00650; HSFOS (415:434). XX RN [1] RX MEDLINE; 93094288. RA Lin X., Wang Z., Gu L., Deuel T. F. RT Functional analysis of the human platelet-derived growth factor A-chain RT promoter region RL J. Biol. Chem. 267:25614-25619 (1992). RN [2] RX MEDLINE; 90214621. RA Schroeter H., Mueller C. G. F., Meese K., Nordheim A. RT Synergism in ternary complex formation between the dimeric glycoprotein RT p67SRF, polypeptide p62TCF and the c-fos serum response element RL EMBO J. 9:1123-1130 (1990). RN [3] RX MEDLINE; 89136003. RA Shaw P. E., Schroeter H., Nordheim A. RT The Ability of a Ternary Complex to Form Over the Serum Response Element RT Correlates with Serum Inducibility of the Human c-fos Promoter RL Cell 56:563-572 (1989). RN [4] RX MEDLINE; 89295579. RA Herrera R. E., Shaw P. E., Nordheim A. RT Occupation of the c-fos serum response element in vivo by a multi-protein RT complex is unaltered by growth factor induction RL Nature 340:68-70 (1989). XX // AC R00468 XX ID HS$CFOS_11 XX DT 20.06.1990 (created); ewi. DT 03.12.1999 (updated); mkl. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SQ TGCGTCA. XX SF -306 ST -292 XX BF T00029; AP-1; Quality: 2; Species: human, Homo sapiens. BF T00051; ATF; Quality: 2; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa SO 0126; K562 XX MM DNase I footprinting MM gel retardation MM UV-crosslinking XX DR TRANSPATH: XN000005779 DR TRANSPATH: XN000007098 DR EMBL: M15429; HSCFOS01 (34:40). DR EMBL: K00650; HSFOS (435:441). XX RN [1] RX MEDLINE; 93281421. RA Svinarchuk F., Mastyugin V., Gorn V., Dobrikov M., Doronin S. RT Determination of the molecular mass of the transcription factor interacting RT with FBS2 in c-fos promoter RL Nucleic Acids Res. 21:2535-2536 (1993). RN [2] RX MEDLINE; 90060016. RA Shaw P. E., Frasch S., Nordheim A. RT Repression of c-fos transcription is mediated through p6SRF bound to the SRE RL EMBO J. 8:2567-2574 (1989). RN [3] RX MEDLINE; 89039849. RA Hyman S. E., Comb M., Lin Y.-S., Pearlberg J., Green M. R., Goodman H. M. RT A Common trans-Acting Factor Is Involved in Transcriptional Regulation of RT Neurotransmitter Genes by Cyclic AMP RL Mol. Cell. Biol. 8:4225-4233 (1988). XX // AC R00469 XX ID HS$CFOS_12 XX DT 20.06.1990 (created); ewi. DT 28.01.1991 (updated); thh. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SF -276 ST -227 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa SO 0170; PC12 XX MM direct gel shift MM gel shift competition XX CC binding factor is the same as at hsp70 -283/-214 XX RN [1] RX MEDLINE; 89071721. RA Visvader J., Sassone-Corsi P., Verma I. RT Two adjacent promoter elements mediate nerve growth factor activation of RT the c-fos gene and bind distinct nuclear complexes RL Proc. Natl. Acad. Sci. USA 85:9474-9478 (1988). XX // AC R00470 XX ID HS$CFOS_13 XX DT 20.06.1990 (created); ewi. DT 31.03.1998 (updated); ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SQ GCGCCACC. SQ GCGCCACC. XX SF -93 ST -74 XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0100; HeLa XX MM direct gel shift XX DR EMBL: V01512; HSCFOS (35:42). DR EMBL: V01512; HSCFOS (49:56). DR EMBL: K00650; HSFOS (635:642). DR EMBL: K00650; HSFOS (649:656). DR EPD: EP11145; HS_FOS. XX RN [1] RX MEDLINE; 88065485. RA Fisch T. M., Prywes R., Roeder R. G. RT c-fos Sequences Necessary for Basal Expression and Induction by Epidermal RT Growth Factor, 12-O-Tetradecanoyl Phorbol-13-Acetate, and the Calcium RT Ionophore RL Mol. Cell. Biol. 7:3490-3502 (1987). XX // AC R00471 XX ID HS$CFOS_14 XX DT 20.06.1990 (created); ewi. DT 30.11.1994 (updated); thh; ewi. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000218. XX SQ GTGACGTT. XX EL Ca-CRE XX SF -70 ST -50 XX BF T00442; 47-kDa CRE bind. prot.; Quality: 6; Species: rat, Rattus norvegicus. BF T00167; CRE-BP1; Quality: 6; Species: human, Homo sapiens. BF T00163; CREB; Quality: 2; Species: human, Homo sapiens. BF T00164; CREB; Quality: 2; Species: rat, Rattus norvegicus. BF T01307; CREB; Quality: 6; Species: hamster. BF T00846; TREB-1; Quality: 6; Species: human, Homo sapiens. XX OS human, Homo sapiens OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; primates XX SO 0023; A431 SO 0100; HeLa SO 0121; JEG-3 SO 0170; PC12 SO 0353; rec(human-lambda) SO 0711; brain XX MM DNase I footprinting MM direct gel shift MM supershift (antibody binding) MM gel shift competition XX CC rel. affinity of CRE-BP1 comp. to MHC Aalpha-el.=0.2 XX DR TRANSPATH: XN000005780 DR TRANSPATH: XN000005781 DR TRANSPATH: XN000005782 DR TRANSPATH: XN000007587 DR TRANSPATH: XN000008191 DR TRANSPATH: XN000008727 DR EMBL: V01512; HSCFOS (69:76). DR EMBL: K00650; HSFOS (669:676). DR EPD: EP11145; HS_FOS. XX RN [1] RX MEDLINE; 93227031. RA Ginty D. D., Kornhauser J. M., Thompson M. A., Bading H., Mayo K. E., RA Takahashi J. S., Greenberg M. E. RT Regulation of CREB phosphorylation in the suprachiasmatic nucleus by light RT and a circadian clock RL Science 260:238-241 (1993). RN [2] RX MEDLINE; 91334123. RA Haertig E., Loncarevic I. F., Buescher M., Herrlich P., Rahmsdorf H. J. RT A new cAMP response element in the transcribed region of the human c-fos RT gene RL Nucleic Acids Res. 19:4153-4159 (1991). RN [3] RX MEDLINE; 90205810. RA Kara C. J., Liou H.-C., Ivashkiv L. B., Glimcher L. H. RT A cDNA for a human cyclic AMP response element-binding protein which is RT distinct from CREB and expressed preferentially in brain RL Mol. Cell. Biol. 10:1347-1357 (1990). RN [4] RX MEDLINE; 89214111. RA Kwast-Welfeld J., Soong C.-J., Short M. L., Jungmann R. A. RT Identification of Rat Ovarian Nuclear Factors That Interact with the RT cAMP-inducible Lactate Dehydrogenase A Subunit Promoter RL J. Biol. Chem. 264:6941-6947 (1989). RN [5] RX MEDLINE; 89261803. RA Tan T.-H., Horikoshi M., Roeder R. G. RT Purification and Characterization of Multiple Nuclear Factors That Bind to RT the TAX-Inducible Enhancer within the Human T-Cell Leukemia Virus Long RT Terminal Repeat RL Mol. Cell. Biol. 9:1733-1745 (1989). RN [6] RX MEDLINE; 89107989. RA Sassone-Corsi P., Visvader J., Ferland L., Mellon P. L., Verma I. M. RT Induction of proto-oncogene fos transcription through the adenylate cyclase RT pathway: characterization of a cAMP-responsive element RL Genes Dev. 2:1529-1538 (1988). RN [7] RX MEDLINE; 88302438. RA Yamamoto K. K., Gonzalez G. A., Biggs III W. H., Montminy M. R. RT Phosphorylation-induced binding and transcriptional efficacy of nuclear RT factor CREB RL Nature 334:494-498 (1988). RN [8] RX MEDLINE; 88065485. RA Fisch T. M., Prywes R., Roeder R. G. RT c-fos Sequences Necessary for Basal Expression and Induction by Epidermal RT Growth Factor, 12-O-Tetradecanoyl Phorbol-13-Acetate, and the Calcium RT Ionophore RL Mol. Cell. Biol. 7:3490-3502 (1987). XX // AC R00472 XX ID MOUSE$CFOS_01 XX DT 20.06.1990 (created); ewi. DT 29.11.1999 (updated); mkl. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000486. XX SQ GGATGTCCATATTAGGacatctg. XX EL SRE XX SF -315 ST -293 XX BF T02059; MHox (K-2); Quality: 2; Species: human, Homo sapiens. BF T02321; SRE-ZBP; Quality: 2; Species: human, Homo sapiens. BF T00764; SRF; Quality: 2; Species: human, Homo sapiens. BF T00765; SRF (504 AA); Quality: 4; Species: mouse, Mus musculus. BF T00915; YY1; Quality: 2; Species: human, Homo sapiens. XX OS mouse, Mus musculus OC eukaryota; animalia; metazoa; chordata; vertebrata; tetrapoda; mammalia; OC eutheria; rodentia; myomorpha; muridae; murinae XX SO 0003; 3T3 SO 0069; F9 SO 0095; H9 SO 0306; rec(human-E.coli) SO 0344; rec(human-COS) XX MM gel retardation MM supershift (antibody binding) MM in vivo / genomic methylation protection MM methylation interference XX CC first GG not contacted in F9 genomic DNA; YY1 binding is essential for CC enhancement of SRF binding [1]; factors YY1 and SRF, and the SRE element CC form a ternary complex in which YY1 recognizes the major groove of the A-T CC core, while SRF simultaneously occupies the minor groove on the opposite CC face of the DNA helix [1]; SRE acts as a pressure response element [2] XX DR TRANSPATH: XN000008086 DR TRANSPATH: XN000008338 DR TRANSPATH: XN000009144 DR TRANSPATH: XN000009211 DR TRANSPATH: XN000014287 DR EMBL: V00727; MMCFOS (238:260). DR EMBL: M23768; MMCFOS5F (238:260). DR EMBL: K03231; MMFOSA (247:269). DR EPD: EP11144; MM_FOS. XX RN [1] RX MEDLINE; 96025978. RA Natesan S., Gilman M. RT YY1 facilitates the association of serum response factor with the c-fos RT serum response element RL Mol. Cell. Biol. 15:5975-5982 (1995). RN [2] RX MEDLINE; 94086532. RA Aoyagi T., Izumo S. RT Mapping of the pressure response element of the c-fos gene by direct DNA RT injection into beating hearts RL J. Biol. Chem. 268:27176-27179 (1993). RN [3] RX MEDLINE; 92236619. RA Attar R. M., Gilman M. Z. RT Expression of a novel zinc finger protein that binds to the c-fos serum RT response element RL Mol. Cell. Biol. 12:2432-2443 (1992). RN [4] RX MEDLINE; 91305104. RA Koenig H. RT Cell-type specific multiprotein complex formation over the c-fos serum RT response element in vivo: ternary complex formation is not required for the RT induction of c-fos RL Nucleic Acids Res. 19:3607-3611 (1991). RN [5] RX MEDLINE; 89356653. RA Ryan jr W. A., Franza jr B. R., Gilman M. Z. RT Two distinct cellular phospholipoproteins bind to the c-fos serum response RT element RL EMBO J. 8:1785-1792 (1989). XX // AC R00473 XX ID MOUSE$CFOS_02 XX DT 20.06.1990 (created); ewi. DT 25.08.1995 (updated); hiwi. CO Copyright (C), Biobase GmbH. XX TY D XX DE c-fos; Gene: G000486. XX SQ GATGTCCatATtaGGACATC. XX SF -313 ST -297 XX BF T00279; factor 1; Quality: 6; Species: mouse, Mus musculus.